National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14213R-1 
 Symbol CG14213  Full Name CG14213 
 CG No CG14213  Old CG No CG14213 
 Synonyms CAF40, CG14213 
 Accession No (Link to NCBI) NM_167675.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shan L, Wu C, Chen D, Hou L, Li X, Wang L, Chu X, Hou Y, Wang Z.
Regulators of alternative polyadenylation operate at the transition from mitosis to meiosis.
J Genet Genomics (2017) 44(2) 95-106 [ PubMed ID = 28190776 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCTCAACCGAGTCCGCATA 
 Primer Seq. 3'
aatctagaggtaccGATCTCGGTGGTCAGCAGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGCTCAACC GAGTCCGCAT ATGAATCCTC AGCAGCAGCA GCAGCAGCAA CAGCAGCAGC 
0061 AGCAGACCGA GCAGGAGAAG GTGTACCAGT GGATCAATGA GCTGGCCCAT CCGGACACGC 
0121 GTGAAACCGC TCTGCTCGAG CTAAGCAAGA AGCGTGAGAC GGACCTGGCC CCCATGCTGT 
0181 GGAACAGCTT CGGGACCGCC TGCGCCCTGT TGCAGGAGAT TGTTAACATC TACCCATCGA 
0241 TAACGCCGCC CACTTTGACG GCCCACCAGT CGAACCGCGT GTGCAACGCC CTGGNGCTGC 
0301 TGCAGTGCGT CGCCTCGCAC CCGGAGACTC GCACGGCCTT CCTGCAGGCC CAGATACCGC 
0361 TGTACTTGTA CCCTTTCTTG TCGACCACGT CCAAGACCAG GCCCTTCGAG TACTTGCGCC 
0421 TGACCAGTTT GGGCGTGATT GGTGCTCTGG TCAAGACCGA CGAACAGGAG GTGATCACCT 
0481 TTCTGCTGAC CACCGAGATC  
 in silico PCR Fragment
0001 GTGCTCAACC GAGTCCGCAT ATGAATCCTC AGCAGCAGCA GCAGCAGCAA CAGCAGCAGC 
0061 AGCAGACCGA GCAGGAGAAG GTGTACCAGT GGATCAATGA GCTGGCCCAT CCGGACACGC 
0121 GTGAAACCGC TCTGCTCGAG CTAAGCAAGA AGCGTGAGAC GGACCTGGCC CCCATGCTGT 
0181 GGAACAGCTT CGGGACCGCC TGCGCCCTGT TGCAGGAGAT TGTTAACATC TACCCATCGA 
0241 TAACGCCGCC CACTTTGACG GCCCACCAGT CGAACCGCGT GTGCAACGCC CTGGCGCTGC 
0301 TGCAGTGCGT CGCCTCGCAC CCGGAGACTC GCACGGCCTT CCTGCAGGCC CAGATACCGC 
0361 TGTACTTGTA CCCTTTCTTG TCGACCACGT CCAAGACCAG GCCCTTCGAG TACTTGCGCC 
0421 TGACCAGTTT GGGCGTGATT GGTGCTCTGG TCAAGACCGA CGAACAGGAG GTGATCACCT 
0481 TTCTGCTGAC CACCGAGATC  
 Assemble Data

14213R-1.IR_full       1   GTGCTCAACCGAGTCCGCATATGAATCCTCAGCAGCAGCAGCAGCAGCAACAGCAGCAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     1   GTGCTCAACCGAGTCCGCATATGAATCCTCAGCAGCAGCAGCAGCAGCAACAGCAGCAGC 60


14213R-1.IR_full       61  AGCAGACCGAGCAGGAGAAGGTGTACCAGTGGATCAATGAGCTGGCCCATCCGGACACGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     61  AGCAGACCGAGCAGGAGAAGGTGTACCAGTGGATCAATGAGCTGGCCCATCCGGACACGC 120


14213R-1.IR_full       121 GTGAAACCGCTCTGCTCGAGCTAAGCAAGAAGCGTGAGACGGACCTGGCCCCCATGCTGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     121 GTGAAACCGCTCTGCTCGAGCTAAGCAAGAAGCGTGAGACGGACCTGGCCCCCATGCTGT 180


14213R-1.IR_full       181 GGAACAGCTTCGGGACCGCCTGCGCCCTGTTGCAGGAGATTGTTAACATCTACCCATCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     181 GGAACAGCTTCGGGACCGCCTGCGCCCTGTTGCAGGAGATTGTTAACATCTACCCATCGA 240


14213R-1.IR_full       241 TAACGCCGCCCACTTTGACGGCCCACCAGTCGAACCGCGTGTGCAACGCCCTGGNGCTGC 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
14213R-1.in silico     241 TAACGCCGCCCACTTTGACGGCCCACCAGTCGAACCGCGTGTGCAACGCCCTGGCGCTGC 300


14213R-1.IR_full       301 TGCAGTGCGTCGCCTCGCACCCGGAGACTCGCACGGCCTTCCTGCAGGCCCAGATACCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     301 TGCAGTGCGTCGCCTCGCACCCGGAGACTCGCACGGCCTTCCTGCAGGCCCAGATACCGC 360


14213R-1.IR_full       361 TGTACTTGTACCCTTTCTTGTCGACCACGTCCAAGACCAGGCCCTTCGAGTACTTGCGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     361 TGTACTTGTACCCTTTCTTGTCGACCACGTCCAAGACCAGGCCCTTCGAGTACTTGCGCC 420


14213R-1.IR_full       421 TGACCAGTTTGGGCGTGATTGGTGCTCTGGTCAAGACCGACGAACAGGAGGTGATCACCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14213R-1.in silico     421 TGACCAGTTTGGGCGTGATTGGTGCTCTGGTCAAGACCGACGAACAGGAGGTGATCACCT 480


14213R-1.IR_full       481 TTCTGCTGACCACCGAGATC 500
                           ||||||||||||||||||||
14213R-1.in silico     481 TTCTGCTGACCACCGAGATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  20  90  42  NM_134491.2  CG14213-RB, transcript variant B (CG14213), mRNA 
100   482  20  90  42  NM_167675.1  CG14213-RA, transcript variant A (CG14213), mRNA 
37.96   183  963  1580  2192  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
37.96   183  963  1580  2192  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
37.96   183  963  1580  2192  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
11.61   56  347  742  1234  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
11.61   56  347  742  1234  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
10.16   49  225  473  784  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
9.33   45  229  472  822  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
9.33   45  229  472  822  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
8.71   42  197  379  630  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
8.71   42  128  574  812  NM_139493.2  CG2083-RA (CG2083), mRNA 
8.71   42  115  520  596  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
8.71   42  111  488  528  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
8.5   41  234  675  1057  NM_001038734.1  CG16902-RC (Hr4), mRNA 
8.5   41  200  534  818  NM_079903.2  CG15319-RB (nej), mRNA 
8.5   41  120  360  305  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
8.29   40  137  395  468  NM_167000.1  CG32778-RA (CG32778), mRNA 
8.09   39  187  431  455  NM_134474.4  CG32532-RA (CG32532), mRNA 
7.88   38  98  315  403  NM_132004.2  CG4136-RA (CG4136), mRNA 
7.26   35  203  291  431  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
7.26   35  203  291  431  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
7.26   35  123  255  349  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
7.26   35  123  255  349  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
7.26   35  95  310  259  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
6.84   33  171  455  775  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
6.84   33  171  455  775  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
6.84   33  171  455  773  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
6.63   32  115  330  516  NM_079507.2  CG2530-RA (corto), mRNA 
6.43   31  160  367  531  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.