National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14212R-1 
 Symbol CG14212  Full Name CG14212 
 CG No CG14212  Old CG No CG14212 
 Synonyms CG14212 
 Accession No (Link to NCBI) NM_134489.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAGCCTCCGGTTGAGCCGTT 
 Primer Seq. 3'
aatctagaggtaccGTCAGTCTGCTCTTGGTAGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAAGCCTCCG GTTGAGCCGT TGCCTTTCGc NCTTCGGACG CGGTCTGAGC GCATCCAGTT 
0061 CGCCTGGACC GCGCACCCTA GTCGCCATCG ACTTCGACAG GACCATCGTT GAGCAGGACT 
0121 CCTATTTGGC GGTGAGCCAA CTACTGCCGA CCAGTCAGCG CAAGGAGCTG CAGGACCAGA 
0181 TCCCCAAGTG CGGCTGGCTG AGCTTCATAA GCCAAGTGTT GCAGCNCCTG CATGGCGAGC 
0241 ACAAGGTGAA CTCCGCGTCG GTGGGCAAGC GTGTGCGCAG TCTCACAGCC GTGCCTGGAA 
0301 TGCTGCGGGT GATGCGCCAG TTAGCCCGGA TCCCTGAGCT CGAACTGTGC ATCGTCAGCG 
0361 ACGCCAACTC CTTCTTCATC GGCGAGTGGC TGCAGGCGTA CGCCATTGAG TGCCTCTTTG 
0421 CCGGCGGCGT GTTTCACCAA TNCCCGCATG CGTCCAAGCG AGCGGCGAAA CTGCTGGTGC 
0481 TGCCCTACCA AGAGCAGACT GAC 
 in silico PCR Fragment
0001 GAAGCCTCCG GTTGAGCCGT TGCCTTTCGC CCTTCGGACG CGGTCTGAGC GCATCCAGTT 
0061 CGCCTGGACC GCGCACCCTA GTCGCCATCG ACTTCGACAG GACCATCGTT GAGCAGGACT 
0121 CCTATTTGGC GGTGAGCCAA CTACTGCCGA CCAGTCAGCG CAAGGAGCTG CAGGACCAGA 
0181 TCCCCAAGTG CGGCTGGCTG AGCTTCATAA GCCAAGTGTT GCAGCGCCTG CATGGCGAGC 
0241 ACAAGGTGAA CTCCGCGTCG GTGGGCAAGC GTGTGCGCAG TCTCACAGCC GTGCCTGGAA 
0301 TGCTGCGGGT GATGCGCCAA TTAGCCAGGA TCCCTGAGCT CGAACTGTGC ATCGTCAGCG 
0361 ACGCCAACTC CTTCTTCATC GGCGAGTGGC TGCAGGCGTA CGCCATTGAG TGCCTCTTTG 
0421 CCGGCGGCGT G-TTCACCAA T-CCCGCATG CGTCCAAGCG AGCGGCG-AA CTGCTGGTGC 
0481 TGCCCTACCA AGAGCAGACT GAC 
 Assemble Data

14212R-1.IR_full       1   GAAGCCTCCGGTTGAGCCGTTGCCTTTCGCNCTTCGGACGCGGTCTGAGCGCATCCAGTT 60
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
14212R-1.in silico     1   GAAGCCTCCGGTTGAGCCGTTGCCTTTCGCCCTTCGGACGCGGTCTGAGCGCATCCAGTT 60


14212R-1.IR_full       61  CGCCTGGACCGCGCACCCTAGTCGCCATCGACTTCGACAGGACCATCGTTGAGCAGGACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14212R-1.in silico     61  CGCCTGGACCGCGCACCCTAGTCGCCATCGACTTCGACAGGACCATCGTTGAGCAGGACT 120


14212R-1.IR_full       121 CCTATTTGGCGGTGAGCCAACTACTGCCGACCAGTCAGCGCAAGGAGCTGCAGGACCAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14212R-1.in silico     121 CCTATTTGGCGGTGAGCCAACTACTGCCGACCAGTCAGCGCAAGGAGCTGCAGGACCAGA 180


14212R-1.IR_full       181 TCCCCAAGTGCGGCTGGCTGAGCTTCATAAGCCAAGTGTTGCAGCNCCTGCATGGCGAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
14212R-1.in silico     181 TCCCCAAGTGCGGCTGGCTGAGCTTCATAAGCCAAGTGTTGCAGCGCCTGCATGGCGAGC 240


14212R-1.IR_full       241 ACAAGGTGAACTCCGCGTCGGTGGGCAAGCGTGTGCGCAGTCTCACAGCCGTGCCTGGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14212R-1.in silico     241 ACAAGGTGAACTCCGCGTCGGTGGGCAAGCGTGTGCGCAGTCTCACAGCCGTGCCTGGAA 300


14212R-1.IR_full       301 TGCTGCGGGTGATGCGCCAGTTAGCCCGGATCCCTGAGCTCGAACTGTGCATCGTCAGCG 360
                           ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||
14212R-1.in silico     301 TGCTGCGGGTGATGCGCCAATTAGCCAGGATCCCTGAGCTCGAACTGTGCATCGTCAGCG 360


14212R-1.IR_full       361 ACGCCAACTCCTTCTTCATCGGCGAGTGGCTGCAGGCGTACGCCATTGAGTGCCTCTTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14212R-1.in silico     361 ACGCCAACTCCTTCTTCATCGGCGAGTGGCTGCAGGCGTACGCCATTGAGTGCCTCTTTG 420


14212R-1.IR_full       421 CCGGCGGCGTGTTTCACCAATNCCCGCATGCGTCCAAGCGAGCGGCGAAACTGCTGGTGC 480
                           ||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||
14212R-1.in silico     421 CCGGCGGCGTG-TTCACCAAT-CCCGCATGCGTCCAAGCGAGCGGCG-AACTGCTGGTGC 480


14212R-1.IR_full       481 TGCCCTACCAAGAGCAGACTGAC 503
                           |||||||||||||||||||||||
14212R-1.in silico     481 TGCCCTACCAAGAGCAGACTGAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134489.2  CG14212-RA (CG14212), mRNA 
0.2   NM_001031980.1  CG9638-RB, transcript variant B (Ada2b), mRNA 
0.2   NM_141516.2  CG9638-RA, transcript variant A (Ada2b), mRNA 
0   NM_167579.1  CG15814-RD, transcript variant D (CG15814), mRNA 
0   NM_167578.1  CG15814-RC, transcript variant C (CG15814), mRNA 
0   NM_133019.2  CG15814-RA, transcript variant A (CG15814), mRNA 
0   NM_167577.1  CG15814-RB, transcript variant B (CG15814), mRNA 
0   NR_002102.1  CR32730, miscRNA 
0   NM_142043.1  CG9637-RA (Task6), mRNA 
0   NM_136638.2  CG8799-RA (l(2)03659), mRNA 
0   NM_080366.2  CG2238-RA, transcript variant A (Ef2b), mRNA 
0   NM_165395.1  CG2238-RC, transcript variant C (Ef2b), mRNA 
0   NM_165394.1  CG2238-RB, transcript variant B (Ef2b), mRNA 
0   NM_134492.2  CG12237-RA (CG12237), mRNA 
0   NM_057751.2  CG8161-RA (Rlb1), mRNA 
0   NM_136206.1  CG2617-RA (CG2617), mRNA 
0   NM_079359.3  CG17962-RA (Z600), mRNA 
0   NM_143505.2  CG7920-RA, transcript variant A (CG7920), mRNA 
0   NM_001038960.1  CG33976-RA (Octbeta2R), mRNA 
0   NM_170139.1  CG31132-RA (BRWD3), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_137084.2  CG8241-RA (CG8241), mRNA 
0   NM_166519.1  CG3074-RA, transcript variant A (CG3074), mRNA 
0   NM_137808.2  CG3074-RB, transcript variant B (CG3074), mRNA 
0   NM_141877.1  CG18347-RA (CG18347), mRNA 
0   NM_170297.1  CG6323-RB, transcript variant B (Tsp97E), mRNA 
0   NM_079800.2  CG6323-RA, transcript variant A (Tsp97E), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_078866.2  CG6549-RA, transcript variant A (fws), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.