National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14211R-4 
 Symbol CG14211  Full Name CG14211 
 CG No CG14211  Old CG No CG14211 
 Synonyms CG14211 
 Accession No (Link to NCBI) NM_134488.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGGTGGACACAGGCCTGTT 
 Primer Seq. 3'
aatctagaggtaccTCTTGGCCTTGCGCATCTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAgGTGGAC ACAGGCCTGT TTCTAGGCAA CCTGACCGCG GCGACGCACA TGGAGACGCT 
0061 GCGCTCCTTC AAGATCACCC ACATCCTCAC GCTGGATTCG GTCCCGCTGC CGCAGCACAT 
0121 TCTGGAGGCC AGCTTTCTGA CCACCAAATA TATACAGATT GCCGACATGC CGCGCGAAGA 
0181 TATTCTGCAG CATCTGGAGG GCTGCGTTGA CTTTATCAGC TCGGCCCTGG cCCAGCAGGG 
0241 CAATGTCCTT GTGCACTGCT ACTTCGGCGT CAGTCGCAGC TCATCCACTG TGATCGCTTA 
0301 CATGATGAAG CGACACAATC TGGACTTCCT GCCCGCCTAC GAGCTGGTCA AGGCCAAACG 
0361 GCGCTTCGTC CAGCCAAACG CTGGCTTTGT CAGCCAACTA AAGCTCTTCC GGCGCATGGG 
0421 CTGCAAGATT GACCCCAACT GCCAGCGCTA CAAGATCCAT CGCCTGCGCC TGGCTGGcGA 
0481 GCAGATGCGC AAGNNCAAGA  
 in silico PCR Fragment
0001 CGAGGTGGAC ACAGGCCTGT TTCTAGGCAA CCTGACCGCG GCGACGCACA TGGAGACGCT 
0061 GCGCTCCTTC AAGATCACCC ACATCCTCAC GCTGGATTCG GTCCCGCTGC CGCAGCACAT 
0121 TCTGGAGGCC AGCTTTCTGA CCACCAAATA TATACAGATT GCCGACATGC CGCGCGAAGA 
0181 TATTCTGCAG CATCTGGAGG GCTGCGTTGA CTTTATCAGC TCGGCCCTGG CCCAGCAGGG 
0241 CAATGTCCTT GTGCACTGCT ACTTCGGCGT CAGTCGCAGC TCATCCACTG TGATCGCTTA 
0301 CATGATGAAG CGACACAATC TGGACTTCCT GCCCGCCTAC GAGCTGGTCA AGGCCAAACG 
0361 GCGCTTCGTC CAGCCAAACG CTGGCTTTGT CAGCCAACTA AAGCTCTTCC GGCGCATGGG 
0421 CTGCAAGATT GACCCCAACT GCCAGCGCTA CAAGATCCAT CGCCTGCGCC TGGCTGGCGA 
0481 GCAGATGCGC AAGGCCAAGA  
 Assemble Data

14211R-4.IR_full       1   CGAGGTGGACACAGGCCTGTTTCTAGGCAACCTGACCGCGGCGACGCACATGGAGACGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     1   CGAGGTGGACACAGGCCTGTTTCTAGGCAACCTGACCGCGGCGACGCACATGGAGACGCT 60


14211R-4.IR_full       61  GCGCTCCTTCAAGATCACCCACATCCTCACGCTGGATTCGGTCCCGCTGCCGCAGCACAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     61  GCGCTCCTTCAAGATCACCCACATCCTCACGCTGGATTCGGTCCCGCTGCCGCAGCACAT 120


14211R-4.IR_full       121 TCTGGAGGCCAGCTTTCTGACCACCAAATATATACAGATTGCCGACATGCCGCGCGAAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     121 TCTGGAGGCCAGCTTTCTGACCACCAAATATATACAGATTGCCGACATGCCGCGCGAAGA 180


14211R-4.IR_full       181 TATTCTGCAGCATCTGGAGGGCTGCGTTGACTTTATCAGCTCGGCCCTGGCCCAGCAGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     181 TATTCTGCAGCATCTGGAGGGCTGCGTTGACTTTATCAGCTCGGCCCTGGCCCAGCAGGG 240


14211R-4.IR_full       241 CAATGTCCTTGTGCACTGCTACTTCGGCGTCAGTCGCAGCTCATCCACTGTGATCGCTTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     241 CAATGTCCTTGTGCACTGCTACTTCGGCGTCAGTCGCAGCTCATCCACTGTGATCGCTTA 300


14211R-4.IR_full       301 CATGATGAAGCGACACAATCTGGACTTCCTGCCCGCCTACGAGCTGGTCAAGGCCAAACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     301 CATGATGAAGCGACACAATCTGGACTTCCTGCCCGCCTACGAGCTGGTCAAGGCCAAACG 360


14211R-4.IR_full       361 GCGCTTCGTCCAGCCAAACGCTGGCTTTGTCAGCCAACTAAAGCTCTTCCGGCGCATGGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     361 GCGCTTCGTCCAGCCAAACGCTGGCTTTGTCAGCCAACTAAAGCTCTTCCGGCGCATGGG 420


14211R-4.IR_full       421 CTGCAAGATTGACCCCAACTGCCAGCGCTACAAGATCCATCGCCTGCGCCTGGCTGGCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14211R-4.in silico     421 CTGCAAGATTGACCCCAACTGCCAGCGCTACAAGATCCATCGCCTGCGCCTGGCTGGCGA 480


14211R-4.IR_full       481 GCAGATGCGCAAGNNCAAGA 500
                           |||||||||||||  |||||
14211R-4.in silico     481 GCAGATGCGCAAGGCCAAGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134488.2  CG14211-RB (CG14211), mRNA 
0   12  NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_143349.1  CG4869-RA (betaTub97EF), mRNA 
0   NM_141498.1  CG14463-RA (CG14463), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   12  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
0   NM_057906.3  CG4067-RA, transcript variant A (pug), mRNA 
0   NM_169351.1  CG4067-RC, transcript variant C (pug), mRNA 
0   NM_140909.1  CG17736-RA (schuy), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_137713.2  CG4266-RA (CG4266), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_080166.2  CG3766-RA (scat), mRNA 
0   NM_058124.2  CG5772-RA (Sur), mRNA 
0   NM_205888.1  CG4629-RC, transcript variant C (CG4629), mRNA 
0   NM_164404.2  CG4629-RB, transcript variant B (CG4629), mRNA 
0   NM_134720.2  CG4629-RA, transcript variant A (CG4629), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   NM_079726.3  CG5374-RA, transcript variant A (T-cp1), mRNA 
0   NM_142250.1  CG14877-RA (CG14877), mRNA 
0   NM_170016.1  CG5374-RB, transcript variant B (T-cp1), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_143239.1  CG14250-RA (CG14250), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.