National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14211R-2 
 Symbol CG14211  Full Name CG14211 
 CG No CG14211  Old CG No CG14211 
 Synonyms CG14211 
 Accession No (Link to NCBI) NM_134488.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGAGGTGGACACAGGCCTGTTTCTAGGCAACCTGACCGCGGCGACGCACATGGAGACGCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGCTCCTTCAAGATCACCCACATCCTCACGCTGGATTCGGTCCCGCTGCCGCAGCACAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTGGAGGCCAGCTTTCTGACCACCAAATATATACAGATTGCCGACATGCCGCGCGAAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TATTCTGCAGCATCTGGAGGGCTGCGTTGACTTTATCAGCTCGGCCCTGGCCCAGCAGGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAATGTCCTTGTGCACTGCTACTTCGGCGTCAGTCGCAGCTCATCCACTGTGATCGCTTA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATGATGAAGCGACACAATCTGGACTTCCTGCCCGCCTACGAGCTGGTCAAGGCCAAACG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGCTTCGTCCAGCCAAACGCTGGCTTTGTCAGCCAACTAAAGCTCTTCCGGCGCATGGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGCAAGATTGACCCCAACTGCCAGCGCTACAAGATCCATCGCCTGCGCCTGGCTGGCGA 480

14211R-2.IR_full       481 GCAGATGCGCAAGNNCAAGA 500
                           |||||||||||||  ||||| silico     481 GCAGATGCGCAAGGCCAAGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134488.2  CG14211-RB (CG14211), mRNA 
0   12  NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_143349.1  CG4869-RA (betaTub97EF), mRNA 
0   NM_141498.1  CG14463-RA (CG14463), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   12  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_169350.1  CG4067-RB, transcript variant B (pug), mRNA 
0   NM_001014614.1  CG4067-RD, transcript variant D (pug), mRNA 
0   NM_057906.3  CG4067-RA, transcript variant A (pug), mRNA 
0   NM_169351.1  CG4067-RC, transcript variant C (pug), mRNA 
0   NM_140909.1  CG17736-RA (schuy), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_137713.2  CG4266-RA (CG4266), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_080166.2  CG3766-RA (scat), mRNA 
0   NM_058124.2  CG5772-RA (Sur), mRNA 
0   NM_205888.1  CG4629-RC, transcript variant C (CG4629), mRNA 
0   NM_164404.2  CG4629-RB, transcript variant B (CG4629), mRNA 
0   NM_134720.2  CG4629-RA, transcript variant A (CG4629), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   NM_079726.3  CG5374-RA, transcript variant A (T-cp1), mRNA 
0   NM_142250.1  CG14877-RA (CG14877), mRNA 
0   NM_170016.1  CG5374-RB, transcript variant B (T-cp1), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_143239.1  CG14250-RA (CG14250), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.