National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14210R-3 
 Symbol CG14210  Full Name CG14210 
 CG No CG14210  Old CG No CG14210 
 Synonyms BcDNA:RE23450, CG14210 
 Accession No (Link to NCBI) NM_134484.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGTGAATCCGCACCGGAAACTGTGCCAGCCAAGAAGCCGGCAAAGGCCAAGAAGGCGGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAAGCCGGAGAACAGCATACCACGCGGCCAGCCCAAGTCGAACCGGCCGTGGAAGACGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAAGCAGAAATTTAGCAAGATTAAGAAGACCGTTAACCGACTGTCCTTCGAAAAGAAGAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCCCTGCGCGACGAGCTGCGCTACATCAAGGAGCGCTCCAAGGAGATCAAGGACAAGCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAGGAGGATGCCGTCCAAAAGCACCAGCGCCGCGTGGAGAATGCCGAGCGCCGGCTGGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACGAGCGCCGCTCGGAGGTCGTCCAGGTCATCAAGAATCCCGCCAAGCTGAAGCGCAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAGAAGAAACAGATGCGCATGATCGAGAAGCGGGACGTCAGCCAGGTGAAGGTGGTC 418

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   400  NM_134484.2  CG14210-RA (CG14210), mRNA 
19.5   78  NM_001031903.1  CG17767-RC, transcript variant C (Tim9b), mRNA 
19.5   78  NM_134485.3  CG12788-RA, transcript variant A (CG12788), mRNA 
0.25   NM_140794.2  CG4108-RA (Chmp1), mRNA 
0.25   NM_166927.1  CG3981-RA, transcript variant A (Unc-76), mRNA 
0.25   NM_130625.2  CG3981-RB, transcript variant B (Unc-76), mRNA 
0.25   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0.25   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0.25   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_167927.1  CG1960-RB, transcript variant B (mu2), mRNA 
0   NM_079163.2  CG1960-RA, transcript variant A (mu2), mRNA 
0   NM_001014549.1  CG4527-RE, transcript variant E (slik), mRNA 
0   NM_166669.1  CG4527-RB, transcript variant B (slik), mRNA 
0   NM_206214.1  CG4527-RC, transcript variant C (slik), mRNA 
0   NM_206213.1  CG4527-RD, transcript variant D (slik), mRNA 
0   NM_138064.2  CG4527-RA, transcript variant A (slik), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   10  NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   10  NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_166388.1  CG11200-RA, transcript variant A (CG11200), mRNA 
0   NM_137627.2  CG11200-RB, transcript variant B (CG11200), mRNA 
0   14  NM_001032023.1  CG11779-RC, transcript variant C (CG11779), mRNA 
0   13  NM_001032022.1  CG11779-RD, transcript variant D (CG11779), mRNA 
0   13  NM_142529.3  CG11779-RA, transcript variant A (CG11779), mRNA 
0   13  NM_169849.1  CG11779-RB, transcript variant B (CG11779), mRNA 
0   NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   NM_165257.1  CG31790-RA (CG31790), mRNA 
0   NM_132030.1  CG15770-RA (CG15770), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.