National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14210R-1 
 Symbol CG14210  Full Name CG14210 
 CG No CG14210  Old CG No CG14210 
 Synonyms BcDNA:RE23450, CG14210 
 Accession No (Link to NCBI) NM_134484.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGTGAATCCGCACCGGAAAC 
 Primer Seq. 3'
aatctagaggtaccGACCACCTTCACCTGGCTGAC 
 Predicted Fragment Size
418 
 IR fragment full Seq
0001 GAGTGAATCC GCACCGGAAA CTGTGCCAGC CAAGAAGCCG GCAAAGGCCA AGAAGGCGGC 
0061 AAAGCCGGAG AACAGCATAC CACGCGGCCA GCCCAAGTCG AACCGGCCGT GGAAGACGCC 
0121 CAAGCAGAAA TTTAGCAAGA TTAAGAAGAC CGTTAACCGA CTGTCCTTCG AAAAGAAGAC 
0181 GGCCCTGCGC GACGAgCTGC GCTACATCAA GGAGCGCTCC AAGGAGATCA AGGACAAGCG 
0241 CAAGGAGGAT GCCGTCCAAA AGCACCAGCG CCGCGTGGAG AATGCCGAGC GCCGGCTGGC 
0301 GAACGAGCGC CGCTCGGAGG TCGTCCAGGT CATCAAGAAT CCCGCCAAGC TGAAGCGCAT 
0361 GAAGAAGAAA CAGATGCGCA TGATCGAGAA GCGGGACGTC AGCCAGGTGA AGGTGGTC 
 in silico PCR Fragment
0001 GAGTGAATCC GCACCGGAAA CTGTGCCAGC CAAGAAGCCG GCAAAGGCCA AGAAGGCGGC 
0061 AAAGCCGGAG AACAGCATAC CACGCGGCCA GCCCAAGTCG AACCGGCCGT GGAAGACGCC 
0121 CAAGCAGAAA TTTAGCAAGA TTAAGAAGAC CGTTAACCGA CTGTCCTTCG AAAAGAAGAC 
0181 GGCCCTGCGC GACGAGCTGC GCTACATCAA GGAGCGCTCC AAGGAGATCA AGGACAAGCG 
0241 CAAGGAGGAT GCCGTCCAAA AGCACCAGCG CCGCGTGGAG AATGCCGAGC GCCGGCTGGC 
0301 GAACGAGCGC CGCTCGGAGG TCGTCCAGGT CATCAAGAAT CCCGCCAAGC TGAAGCGCAT 
0361 GAAGAAGAAA CAGATGCGCA TGATCGAGAA GCGGGACGTC AGCCAGGTGA AGGTGGTC 
 Assemble Data

14210R-1.IR_full       1   GAGTGAATCCGCACCGGAAACTGTGCCAGCCAAGAAGCCGGCAAAGGCCAAGAAGGCGGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     1   GAGTGAATCCGCACCGGAAACTGTGCCAGCCAAGAAGCCGGCAAAGGCCAAGAAGGCGGC 60


14210R-1.IR_full       61  AAAGCCGGAGAACAGCATACCACGCGGCCAGCCCAAGTCGAACCGGCCGTGGAAGACGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     61  AAAGCCGGAGAACAGCATACCACGCGGCCAGCCCAAGTCGAACCGGCCGTGGAAGACGCC 120


14210R-1.IR_full       121 CAAGCAGAAATTTAGCAAGATTAAGAAGACCGTTAACCGACTGTCCTTCGAAAAGAAGAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     121 CAAGCAGAAATTTAGCAAGATTAAGAAGACCGTTAACCGACTGTCCTTCGAAAAGAAGAC 180


14210R-1.IR_full       181 GGCCCTGCGCGACGAGCTGCGCTACATCAAGGAGCGCTCCAAGGAGATCAAGGACAAGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     181 GGCCCTGCGCGACGAGCTGCGCTACATCAAGGAGCGCTCCAAGGAGATCAAGGACAAGCG 240


14210R-1.IR_full       241 CAAGGAGGATGCCGTCCAAAAGCACCAGCGCCGCGTGGAGAATGCCGAGCGCCGGCTGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     241 CAAGGAGGATGCCGTCCAAAAGCACCAGCGCCGCGTGGAGAATGCCGAGCGCCGGCTGGC 300


14210R-1.IR_full       301 GAACGAGCGCCGCTCGGAGGTCGTCCAGGTCATCAAGAATCCCGCCAAGCTGAAGCGCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     301 GAACGAGCGCCGCTCGGAGGTCGTCCAGGTCATCAAGAATCCCGCCAAGCTGAAGCGCAT 360


14210R-1.IR_full       361 GAAGAAGAAACAGATGCGCATGATCGAGAAGCGGGACGTCAGCCAGGTGAAGGTGGTC 418
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14210R-1.in silico     361 GAAGAAGAAACAGATGCGCATGATCGAGAAGCGGGACGTCAGCCAGGTGAAGGTGGTC 418

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   400  NM_134484.2  CG14210-RA (CG14210), mRNA 
19.5   78  NM_001031903.1  CG17767-RC, transcript variant C (Tim9b), mRNA 
19.5   78  NM_134485.3  CG12788-RA, transcript variant A (CG12788), mRNA 
0.25   NM_140794.2  CG4108-RA (Chmp1), mRNA 
0.25   NM_166927.1  CG3981-RA, transcript variant A (Unc-76), mRNA 
0.25   NM_130625.2  CG3981-RB, transcript variant B (Unc-76), mRNA 
0.25   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0.25   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0.25   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_167927.1  CG1960-RB, transcript variant B (mu2), mRNA 
0   NM_079163.2  CG1960-RA, transcript variant A (mu2), mRNA 
0   NM_001014549.1  CG4527-RE, transcript variant E (slik), mRNA 
0   NM_166669.1  CG4527-RB, transcript variant B (slik), mRNA 
0   NM_206214.1  CG4527-RC, transcript variant C (slik), mRNA 
0   NM_206213.1  CG4527-RD, transcript variant D (slik), mRNA 
0   NM_138064.2  CG4527-RA, transcript variant A (slik), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   10  NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   10  NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_166388.1  CG11200-RA, transcript variant A (CG11200), mRNA 
0   NM_137627.2  CG11200-RB, transcript variant B (CG11200), mRNA 
0   14  NM_001032023.1  CG11779-RC, transcript variant C (CG11779), mRNA 
0   13  NM_001032022.1  CG11779-RD, transcript variant D (CG11779), mRNA 
0   13  NM_142529.3  CG11779-RA, transcript variant A (CG11779), mRNA 
0   13  NM_169849.1  CG11779-RB, transcript variant B (CG11779), mRNA 
0   NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   NM_165257.1  CG31790-RA (CG31790), mRNA 
0   NM_132030.1  CG15770-RA (CG15770), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.