National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14209R-2 
 Symbol Shawn  Full Name Shawn 
 CG No CG14209  Old CG No CG14209 
 Synonyms CG14209, CG33075, Shawn 
 Accession No (Link to NCBI) NM_001031902.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCAGTTTGCTGCTGCCAGT 
 Primer Seq. 3'
aatctagaggtaccTCGTGGGCAATGGTATCCGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCAGTTTG CTGCTGCCAG TGCGGCAATG GCGGCTGCTT CCAGTCAAAA TCCGTCGAAG 
0061 GCCACGATGA CGGACCCCCG TTTTCGGATC CGACCCCTGC AGCAAGTGGC ATCCGcCTGT 
0121 ACCGGCGCCA TGGTGACGGC CTGCTTTATG ACCCCTCTGG ATGTGATCAA GACCCGCTTG 
0181 CAGGCACAGC AGCAGGCGCN TGCTCTCAAA CAAGTGTTTC CTCTACTGCA ACGGCCTCAT 
0241 GGACCACATC TGCCCCTGCG GCCCGGACAC GCCCAACCCA GCAGCCGCCA AGCCCGCTCC 
0301 CCGTTTTTCT GGCACCATTG ATGCATTCAT CAAAATCAGC CGCACTGAGG GCATCGGCTC 
0361 CCTGTGGTCG GGGCTCAGCC CAACGCTAAT CTCGGCCCTG CCCTCGACCA TCGTATACTT 
0421 CGTGGCTTAT GAGCAGTTCA AGGCCCGTTT CACCGATATC CACTACAAAT ACACGCGACG 
0481 CCCGGATACC ATTGCCCACG A 
 in silico PCR Fragment
0001 GGCCAGTTTG CTGCTGCCAG TGCGGCAATG GCGGCTGCTT CCAGTCAAAA TCCGTCGAAG 
0061 GCCACGATGA CGGACCCCCG TTTTCGGATC CGACCCCTGC AGCAAGTGGC ATCCGCCTGT 
0121 ACCGGCGCCA TGGTGACGGC CTGCTTTATG ACCCCTCTGG ATGTGATCAA GACCCGCTTG 
0181 CAGGCACAGC AGCAGGCGC- TGCTCTCAAA CAAGTGTTTC CTCTACTGCA ACGGCCTCAT 
0241 GGACCACATC TGCCCCTGCG GCCCGGACAC GCCCAACCCA GCAGCCGCCA AGCCCGCTCC 
0301 CCGTTTTTCT GGCACCATTG ACGCATTCAT CAAAATCAGC CGCACTGAGG GCATCGGCTC 
0361 CCTGTGGTCG GGGCTCAGCC CAACGCTAAT CTCGGCCCTG CCCTCGACCA TCATATACTT 
0421 CGTGGCTTAT GAGCAGTTCA AGGCCCGTTT CACCGATATC CACTACAAAT ACACGCGACG 
0481 CCCGGATACC ATTGCCCACG A 
 Assemble Data

14209R-2.IR_full       1   GGCCAGTTTGCTGCTGCCAGTGCGGCAATGGCGGCTGCTTCCAGTCAAAATCCGTCGAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     1   GGCCAGTTTGCTGCTGCCAGTGCGGCAATGGCGGCTGCTTCCAGTCAAAATCCGTCGAAG 60


14209R-2.IR_full       61  GCCACGATGACGGACCCCCGTTTTCGGATCCGACCCCTGCAGCAAGTGGCATCCGCCTGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     61  GCCACGATGACGGACCCCCGTTTTCGGATCCGACCCCTGCAGCAAGTGGCATCCGCCTGT 120


14209R-2.IR_full       121 ACCGGCGCCATGGTGACGGCCTGCTTTATGACCCCTCTGGATGTGATCAAGACCCGCTTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     121 ACCGGCGCCATGGTGACGGCCTGCTTTATGACCCCTCTGGATGTGATCAAGACCCGCTTG 180


14209R-2.IR_full       181 CAGGCACAGCAGCAGGCGCNTGCTCTCAAACAAGTGTTTCCTCTACTGCAACGGCCTCAT 240
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     181 CAGGCACAGCAGCAGGCGC-TGCTCTCAAACAAGTGTTTCCTCTACTGCAACGGCCTCAT 240


14209R-2.IR_full       241 GGACCACATCTGCCCCTGCGGCCCGGACACGCCCAACCCAGCAGCCGCCAAGCCCGCTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     241 GGACCACATCTGCCCCTGCGGCCCGGACACGCCCAACCCAGCAGCCGCCAAGCCCGCTCC 300


14209R-2.IR_full       301 CCGTTTTTCTGGCACCATTGATGCATTCATCAAAATCAGCCGCACTGAGGGCATCGGCTC 360
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     301 CCGTTTTTCTGGCACCATTGACGCATTCATCAAAATCAGCCGCACTGAGGGCATCGGCTC 360


14209R-2.IR_full       361 CCTGTGGTCGGGGCTCAGCCCAACGCTAATCTCGGCCCTGCCCTCGACCATCGTATACTT 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
14209R-2.in silico     361 CCTGTGGTCGGGGCTCAGCCCAACGCTAATCTCGGCCCTGCCCTCGACCATCATATACTT 420


14209R-2.IR_full       421 CGTGGCTTATGAGCAGTTCAAGGCCCGTTTCACCGATATCCACTACAAATACACGCGACG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14209R-2.in silico     421 CGTGGCTTATGAGCAGTTCAAGGCCCGTTTCACCGATATCCACTACAAATACACGCGACG 480


14209R-2.IR_full       481 CCCGGATACCATTGCCCACGA 501
                           |||||||||||||||||||||
14209R-2.in silico     481 CCCGGATACCATTGCCCACGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  17  NM_001031901.1  CG14209-RC, transcript variant C (Shawn), mRNA 
100   482  17  NM_001031902.1  CG14209-RB, transcript variant B (Shawn), mRNA 
100   482  17  NM_167671.1  CG14208-RA, transcript variant A (Tyler), mRNA 
100   482  17  NM_134483.2  CG14208-RB, transcript variant B (Tyler), mRNA 
100   482  NM_001031900.1  CG14209-RD, transcript variant D (Shawn), mRNA 
0.2   NM_139539.1  CG14959-RA, transcript variant A (CG14959), mRNA 
0.2   NM_206264.1  CG14959-RC, transcript variant C (CG14959), mRNA 
0.2   NM_168009.1  CG14959-RB, transcript variant B (CG14959), mRNA 
0   10  12  NM_130593.3  CG14815-RB, transcript variant B (CG14815), mRNA 
0   10  12  NM_166910.1  CG14815-RA, transcript variant A (CG14815), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_137512.2  CG5469-RD, transcript variant D (Gint3), mRNA 
0   NM_166301.1  CG5469-RB, transcript variant B (Gint3), mRNA 
0   NM_166302.1  CG5469-RC, transcript variant C (Gint3), mRNA 
0   NM_079502.2  CG1059-RA (Karybeta3), mRNA 
0   NM_206270.1  CG10847-RA, transcript variant A (enc), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 
0   NM_079315.2  CG10436-RA (Pbprp1), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   11  NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_141612.2  CG8420-RA (CG8420), mRNA 
0   NM_001038933.1  CG33999-RA (CG33999), mRNA 
0   NM_141289.2  CG2519-RA, transcript variant A (CG2519), mRNA 
0   NM_206431.1  CG2519-RB, transcript variant B (CG2519), mRNA 
0   NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
0   NM_130477.2  CG3038-RA, transcript variant A (CG3038), mRNA 
0   NM_001014601.1  CG11352-RD, transcript variant D (jim), mRNA 
0   NM_143699.2  CG11352-RC, transcript variant C (jim), mRNA 
0   NM_168964.2  CG11352-RB, transcript variant B (jim), mRNA 
0   NM_001043218.1  CG33097-RB, transcript variant B (CG33097), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.