National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14209R-1 
 Symbol Shawn  Full Name Shawn 
 CG No CG14209  Old CG No CG14209 
 Synonyms CG14209, CG33075, Shawn 
 Accession No (Link to NCBI) NM_001031902.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCCAGTTTGCTGCTGCCAGTGCGGCAATGGCGGCTGCTTCCAGTCAAAATCCGTCGAAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCACGATGACGGACCCCCGTTTTCGGATCCGACCCCTGCAGCAAGTGGCATCCGCCTGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCGGCGCCATGGTGACGGCCTGCTTTATGACCCCTCTGGATGTGATCAAGACCCGCTTG 180

                           ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     181 CAGGCACAGCAGCAGGCGC-TGCTCTCAAACAAGTGTTTCCTCTACTGCAACGGCCTCAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGACCACATCTGCCCCTGCGGCCCGGACACGCCCAACCCAGCAGCCGCCAAGCCCGCTCC 300

                           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     301 CCGTTTTTCTGGCACCATTGACGCATTCATCAAAATCAGCCGCACTGAGGGCATCGGCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     361 CCTGTGGTCGGGGCTCAGCCCAACGCTAATCTCGGCCCTGCCCTCGACCATCATATACTT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGTGGCTTATGAGCAGTTCAAGGCCCGTTTCACCGATATCCACTACAAATACACGCGACG 480

14209R-1.IR_full       481 CCCGGATACCATTGCCCACGA 501
                           ||||||||||||||||||||| silico     481 CCCGGATACCATTGCCCACGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  17  NM_001031901.1  CG14209-RC, transcript variant C (Shawn), mRNA 
100   482  17  NM_001031902.1  CG14209-RB, transcript variant B (Shawn), mRNA 
100   482  17  NM_167671.1  CG14208-RA, transcript variant A (Tyler), mRNA 
100   482  17  NM_134483.2  CG14208-RB, transcript variant B (Tyler), mRNA 
100   482  NM_001031900.1  CG14209-RD, transcript variant D (Shawn), mRNA 
0.2   NM_139539.1  CG14959-RA, transcript variant A (CG14959), mRNA 
0.2   NM_206264.1  CG14959-RC, transcript variant C (CG14959), mRNA 
0.2   NM_168009.1  CG14959-RB, transcript variant B (CG14959), mRNA 
0   10  12  NM_130593.3  CG14815-RB, transcript variant B (CG14815), mRNA 
0   10  12  NM_166910.1  CG14815-RA, transcript variant A (CG14815), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_137512.2  CG5469-RD, transcript variant D (Gint3), mRNA 
0   NM_166301.1  CG5469-RB, transcript variant B (Gint3), mRNA 
0   NM_166302.1  CG5469-RC, transcript variant C (Gint3), mRNA 
0   NM_079502.2  CG1059-RA (Karybeta3), mRNA 
0   NM_206270.1  CG10847-RA, transcript variant A (enc), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 
0   NM_079315.2  CG10436-RA (Pbprp1), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   11  NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_141612.2  CG8420-RA (CG8420), mRNA 
0   NM_001038933.1  CG33999-RA (CG33999), mRNA 
0   NM_141289.2  CG2519-RA, transcript variant A (CG2519), mRNA 
0   NM_206431.1  CG2519-RB, transcript variant B (CG2519), mRNA 
0   NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
0   NM_130477.2  CG3038-RA, transcript variant A (CG3038), mRNA 
0   NM_001014601.1  CG11352-RD, transcript variant D (jim), mRNA 
0   NM_143699.2  CG11352-RC, transcript variant C (jim), mRNA 
0   NM_168964.2  CG11352-RB, transcript variant B (jim), mRNA 
0   NM_001043218.1  CG33097-RB, transcript variant B (CG33097), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.