National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14207R-3 
 Symbol CG14207  Full Name CG14207 
 CG No CG14207  Old CG No CG14207 
 Synonyms CG14207 
 Accession No (Link to NCBI) NM_134482.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCGAGGCTAACAAGAGGAATATCCCCATCAAGCTGGGCGACTTCAGCGTCATCGAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGAGTTCAGCAACATCCGCGAGCGCTTCGACTCCGAGATGCGCAAAATGGAGGAGGAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGGCCAAGTTCCGTCACGAGCTGATGAACCGCGAGGCGAACTTCTTCGAGTCCACCAGC 180

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCAACGAC-AAACTCGGCGCTGCCATCCCGAATCCCAAAGCAACAGAACTACGTCTCCGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATTAGCTCACCCTTGATCCAGGATGAGGGCGATAACAAAGTGCTGAAGCTGCGTTTCGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGTCAGCCAGTATGCGCCCGAGGAAATTGTTGTGAAAACCGTCGACCAGAAGCTATTGGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCACGCCAAGCACGAGGAGAAGTCGGACACAAAGAGCGTGTACAGGGAGTACAATCGGGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTTCCTGCTGCCCAAGGGCGTCAATCCCGAGTCCATCCGCTCGTCCCTCAGCAAGGACGG 480

14207R-3.IR_full       481 AGTCCTGACCGTG 493
                           ||||||||||||| silico     481 AGTCCTGACCGTG 493

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   474  NM_134482.2  CG14207-RA, transcript variant A (CG14207), mRNA 
97.89   464  NM_167669.1  CG14207-RB, transcript variant B (CG14207), mRNA 
0   NM_137366.2  CG18468-RA (Lhr), mRNA 
0   NM_079466.2  CG18332-RA (CSN3), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_165834.1  CG7777-RA, transcript variant A (CG7777), mRNA 
0   NM_168906.1  CG5081-RB, transcript variant B (Syx7), mRNA 
0   NM_168905.1  CG5081-RA, transcript variant A (Syx7), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   NM_136422.2  CG1845-RA (CG1845), mRNA 
0   NM_136117.2  CG17544-RA, transcript variant A (CG17544), mRNA 
0   NM_165290.1  CG17544-RB, transcript variant B (CG17544), mRNA 
0   NM_165291.1  CG17544-RC, transcript variant C (CG17544), mRNA 
0   11  NM_176408.1  CG33097-RA, transcript variant A (CG33097), mRNA 
0   11  NM_001043218.1  CG33097-RB, transcript variant B (CG33097), mRNA 
0   NM_134861.1  CG2843-RA (CG2843), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_137016.3  CG17041-RA, transcript variant A (CG17041), mRNA 
0   NM_165978.1  CG17041-RC, transcript variant C (CG17041), mRNA 
0   NM_165977.1  CG17041-RB, transcript variant B (CG17041), mRNA 
0   NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_136835.2  CG9035-RA (Tapdelta), mRNA 
0   NM_137069.2  CG13343-RA (CG13343), mRNA 
0   NM_143089.2  CG11849-RA (dan), mRNA 
0   NM_137307.1  CG15617-RA (CG15617), mRNA 
0   NM_133164.2  CG10142-RA (Ance-5), mRNA 
0   NM_057464.3  CG5779-RA (Bc), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.