National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14207R-1 
 Symbol CG14207  Full Name CG14207 
 CG No CG14207  Old CG No CG14207 
 Synonyms CG14207 
 Accession No (Link to NCBI) NM_134482.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCGAGGCTAACAAGAGG 
 Primer Seq. 3'
aatctagaggtaccCACGGTCAGGACTCCGTCCTT 
 Predicted Fragment Size
492 
 IR fragment full Seq
0001 ATGGcCGAGG CTAACAAGAG GAATATCCCC ATCAAGCTGG GCGACTTCAG CGTCATCGAC 
0061 ACGGAGTTCA GCAACATCCG CGAGCGCTTC GACTCCGAGA TGCGCAAAAT GGAGGAGGAG 
0121 ATGGCCAAGT TCCGTCACGA GCTGATGAAC CGCGAGGCGA ACTTCTTCGA GTCCACCAGC 
0181 TCAACGACAA AACTCGGCGC TGCCATCCCG AATCCCAAAG CAACAGAACT ACGTCTCCGA 
0241 CATTAGCTCA CCCTTGATCC AGGATGAGGG CGATAACAAA GTGCTGAAGC TGCGTTTCGA 
0301 TGTCAGCCAG TATGCGCCCG AGGAAATTGT TGTGAAAACC GTCGACCAGA AGCTATTGGT 
0361 GCACGCCAAG CACGAGGAGA AGTCGGACAC AAAGAGCGTG TACAGGGAGT ACAATCGGGA 
0421 GTTCCTGCTG CCCAAGGGCG TCAATCCCGA GTCCATCCGC TCGTCCCTCA GCAAGgACGG 
0481 AGTCCTGACC GTG 
 in silico PCR Fragment
0001 ATGGCCGAGG CTAACAAGAG GAATATCCCC ATCAAGCTGG GCGACTTCAG CGTCATCGAC 
0061 ACGGAGTTCA GCAACATCCG CGAGCGCTTC GACTCCGAGA TGCGCAAAAT GGAGGAGGAG 
0121 ATGGCCAAGT TCCGTCACGA GCTGATGAAC CGCGAGGCGA ACTTCTTCGA GTCCACCAGC 
0181 TCAACGAC-A AACTCGGCGC TGCCATCCCG AATCCCAAAG CAACAGAACT ACGTCTCCGA 
0241 CATTAGCTCA CCCTTGATCC AGGATGAGGG CGATAACAAA GTGCTGAAGC TGCGTTTCGA 
0301 TGTCAGCCAG TATGCGCCCG AGGAAATTGT TGTGAAAACC GTCGACCAGA AGCTATTGGT 
0361 GCACGCCAAG CACGAGGAGA AGTCGGACAC AAAGAGCGTG TACAGGGAGT ACAATCGGGA 
0421 GTTCCTGCTG CCCAAGGGCG TCAATCCCGA GTCCATCCGC TCGTCCCTCA GCAAGGACGG 
0481 AGTCCTGACC GTG 
 Assemble Data

14207R-1.IR_full       1   ATGGCCGAGGCTAACAAGAGGAATATCCCCATCAAGCTGGGCGACTTCAGCGTCATCGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     1   ATGGCCGAGGCTAACAAGAGGAATATCCCCATCAAGCTGGGCGACTTCAGCGTCATCGAC 60


14207R-1.IR_full       61  ACGGAGTTCAGCAACATCCGCGAGCGCTTCGACTCCGAGATGCGCAAAATGGAGGAGGAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     61  ACGGAGTTCAGCAACATCCGCGAGCGCTTCGACTCCGAGATGCGCAAAATGGAGGAGGAG 120


14207R-1.IR_full       121 ATGGCCAAGTTCCGTCACGAGCTGATGAACCGCGAGGCGAACTTCTTCGAGTCCACCAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     121 ATGGCCAAGTTCCGTCACGAGCTGATGAACCGCGAGGCGAACTTCTTCGAGTCCACCAGC 180


14207R-1.IR_full       181 TCAACGACAAAACTCGGCGCTGCCATCCCGAATCCCAAAGCAACAGAACTACGTCTCCGA 240
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     181 TCAACGAC-AAACTCGGCGCTGCCATCCCGAATCCCAAAGCAACAGAACTACGTCTCCGA 240


14207R-1.IR_full       241 CATTAGCTCACCCTTGATCCAGGATGAGGGCGATAACAAAGTGCTGAAGCTGCGTTTCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     241 CATTAGCTCACCCTTGATCCAGGATGAGGGCGATAACAAAGTGCTGAAGCTGCGTTTCGA 300


14207R-1.IR_full       301 TGTCAGCCAGTATGCGCCCGAGGAAATTGTTGTGAAAACCGTCGACCAGAAGCTATTGGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     301 TGTCAGCCAGTATGCGCCCGAGGAAATTGTTGTGAAAACCGTCGACCAGAAGCTATTGGT 360


14207R-1.IR_full       361 GCACGCCAAGCACGAGGAGAAGTCGGACACAAAGAGCGTGTACAGGGAGTACAATCGGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     361 GCACGCCAAGCACGAGGAGAAGTCGGACACAAAGAGCGTGTACAGGGAGTACAATCGGGA 420


14207R-1.IR_full       421 GTTCCTGCTGCCCAAGGGCGTCAATCCCGAGTCCATCCGCTCGTCCCTCAGCAAGGACGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14207R-1.in silico     421 GTTCCTGCTGCCCAAGGGCGTCAATCCCGAGTCCATCCGCTCGTCCCTCAGCAAGGACGG 480


14207R-1.IR_full       481 AGTCCTGACCGTG 493
                           |||||||||||||
14207R-1.in silico     481 AGTCCTGACCGTG 493

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   474  NM_134482.2  CG14207-RA, transcript variant A (CG14207), mRNA 
97.89   464  NM_167669.1  CG14207-RB, transcript variant B (CG14207), mRNA 
0   NM_137366.2  CG18468-RA (Lhr), mRNA 
0   NM_079466.2  CG18332-RA (CSN3), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_165834.1  CG7777-RA, transcript variant A (CG7777), mRNA 
0   NM_168906.1  CG5081-RB, transcript variant B (Syx7), mRNA 
0   NM_168905.1  CG5081-RA, transcript variant A (Syx7), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   NM_136422.2  CG1845-RA (CG1845), mRNA 
0   NM_136117.2  CG17544-RA, transcript variant A (CG17544), mRNA 
0   NM_165290.1  CG17544-RB, transcript variant B (CG17544), mRNA 
0   NM_165291.1  CG17544-RC, transcript variant C (CG17544), mRNA 
0   11  NM_176408.1  CG33097-RA, transcript variant A (CG33097), mRNA 
0   11  NM_001043218.1  CG33097-RB, transcript variant B (CG33097), mRNA 
0   NM_134861.1  CG2843-RA (CG2843), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_137016.3  CG17041-RA, transcript variant A (CG17041), mRNA 
0   NM_165978.1  CG17041-RC, transcript variant C (CG17041), mRNA 
0   NM_165977.1  CG17041-RB, transcript variant B (CG17041), mRNA 
0   NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_136835.2  CG9035-RA (Tapdelta), mRNA 
0   NM_137069.2  CG13343-RA (CG13343), mRNA 
0   NM_143089.2  CG11849-RA (dan), mRNA 
0   NM_137307.1  CG15617-RA (CG15617), mRNA 
0   NM_133164.2  CG10142-RA (Ance-5), mRNA 
0   NM_057464.3  CG5779-RA (Bc), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.