National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14186R-3 
 Symbol CG14186  Full Name CG14186 
 CG No CG14186  Old CG No CG14186 
 Synonyms CG14186 
 Accession No (Link to NCBI) NM_140917.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGAGGCAAAGGTGCACCGCCAGCATCAACGGCATCGTCGCACGGAGGCGCGACAGCGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCCTGGAACGGGAGGCGGTGGCTACGGGAGCGGCAGCTCCAACGCCCACCACGCCCGAG 120

                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGGCAG-AGGCCTTGGACTGTGCCACAGCCCTCAACGAGGGCGTGGTATCCGCGGATCC 180

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGCGGCAGCGGCGGTACGCCAAGCAGTGCGGGTCGCATCAGTGCCCAGAGCTCGGCGGA 240

                           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     241 CAGCATAGAGCTGGTGGGTTC-GCCCAGCCAGACGTCGCAGCAAACGGTGGTGCTGGTCA 300

                           |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     301 ACGGCCACGCCCCGCCGGGCCAGGAGGAGGGGGAGGAGGA-GTCGCCACTGGGCGCAGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AATACCAGGGACTCACCGCCGCCGCCCAAGCAGAGCGATGGCAGTCGCAACTCATCCGGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GATGCGATGAGTCTGCGGGAGACCCTGCAGCAACTACCGGCCACCCATCACCATCGGTCC 480

14186R-3.IR_full       481 AGGCGAACTCACTCACCTGCTGA 503
                           ||||||||||||||||||||||| silico     481 AGGCGAACTCACTCACCTGCTGA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140917.1  CG14186-RA (CG14186), mRNA 
0.41   NM_057629.3  CG4379-RA, transcript variant A (Pka-C1), mRNA 
0.41   NM_164866.1  CG4379-RB, transcript variant B (Pka-C1), mRNA 
0.41   NM_205950.1  CG4379-RC, transcript variant C (Pka-C1), mRNA 
0.2   18  35  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0.2   10  NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0.2   NM_134708.2  CG13949-RA (CG13949), mRNA 
0   16  23  38  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   16  23  38  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   10  11  32  NM_135975.2  CG31781-RB (CG31781), mRNA 
0   13  39  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   17  NM_176374.1  CG4761-RA (knrl), mRNA 
0   17  36  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   15  42  NM_167340.1  CG32648-RA (Pde9), mRNA 
0   13  23  NM_057406.3  CG6222-RA (su(s)), mRNA 
0   19  NM_135495.2  CG4778-RA (CG4778), mRNA 
0   18  35  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   12  18  NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
0   12  18  NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
0   10  25  NM_167309.1  CG32663-RA (CG32663), mRNA 
0   13  27  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   11  17  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
0   10  25  NM_141658.3  CG8301-RA (CG8301), mRNA 
0   10  14  NM_138057.1  CG13576-RA (CG13576), mRNA 
0   10  12  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0   15  NM_143222.1  CG14237-RA (CG14237), mRNA 
0   19  NM_134510.1  CG12703-RA (CG12703), mRNA 
0   15  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   14  NM_164653.1  CG31646-RA (CG31646), mRNA 
0   19  46  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.