National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14186R-1 
 Symbol CG14186  Full Name CG14186 
 CG No CG14186  Old CG No CG14186 
 Synonyms CG14186 
 Accession No (Link to NCBI) NM_140917.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGGCAAAGGTGCACCGC 
 Primer Seq. 3'
aatctagaggtaccTCAGCAGGTGAGTGAGTTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAGGCAA AGGTGCACCG CCAGCATCAA CGGCATCGTC GCACGGAGGC GCGACAGCGG 
0061 CGCCTGGAAC GGGAGGCGGT GGCTACGGGA GCGGCAGCTC CAACGCCCAC CACGCCCGAG 
0121 CgGGCAGNAG GCCTTGGACT GTGCCACAGC CCTCAACGAG GGCGTGGTAT CCGCGGATCC 
0181 GGGCGGCANC GGCGGTACGC CAAGCAGTGC GGGTCGCATC AGTGCCCAGA GCTCGGCGGA 
0241 CAGCATAGAG CTGGTGGGTT CNGCCCAGCC AGACGTCGCA GCAAACGGTG GTGCTGGTCA 
0301 ACGGCCACGC CCCGCCGGGC CAGGAGGAGG GGGAGGAGGA NGTCGCCACT GGGCGCAGGC 
0361 AATACCAGGG ACTCACCGCC GCCGCCCAAG CAGAGCGATG GCAGTCGCAA CTCATCCGGC 
0421 GATGCGATGA GTCTGCGGGA GACCCTGCAG CAACTACCGG CCACCCATCA CCATCGGTCC 
0481 AGGCGAACTC ACTCACCTGC TGA 
 in silico PCR Fragment
0001 ATGGAGGCAA AGGTGCACCG CCAGCATCAA CGGCATCGTC GCACGGAGGC GCGACAGCGG 
0061 CGCCTGGAAC GGGAGGCGGT GGCTACGGGA GCGGCAGCTC CAACGCCCAC CACGCCCGAG 
0121 CGGGCAG-AG GCCTTGGACT GTGCCACAGC CCTCAACGAG GGCGTGGTAT CCGCGGATCC 
0181 GGGCGGCAGC GGCGGTACGC CAAGCAGTGC GGGTCGCATC AGTGCCCAGA GCTCGGCGGA 
0241 CAGCATAGAG CTGGTGGGTT C-GCCCAGCC AGACGTCGCA GCAAACGGTG GTGCTGGTCA 
0301 ACGGCCACGC CCCGCCGGGC CAGGAGGAGG GGGAGGAGGA -GTCGCCACT GGGCGCAGGC 
0361 AATACCAGGG ACTCACCGCC GCCGCCCAAG CAGAGCGATG GCAGTCGCAA CTCATCCGGC 
0421 GATGCGATGA GTCTGCGGGA GACCCTGCAG CAACTACCGG CCACCCATCA CCATCGGTCC 
0481 AGGCGAACTC ACTCACCTGC TGA 
 Assemble Data

14186R-1.IR_full       1   ATGGAGGCAAAGGTGCACCGCCAGCATCAACGGCATCGTCGCACGGAGGCGCGACAGCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     1   ATGGAGGCAAAGGTGCACCGCCAGCATCAACGGCATCGTCGCACGGAGGCGCGACAGCGG 60


14186R-1.IR_full       61  CGCCTGGAACGGGAGGCGGTGGCTACGGGAGCGGCAGCTCCAACGCCCACCACGCCCGAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     61  CGCCTGGAACGGGAGGCGGTGGCTACGGGAGCGGCAGCTCCAACGCCCACCACGCCCGAG 120


14186R-1.IR_full       121 CGGGCAGNAGGCCTTGGACTGTGCCACAGCCCTCAACGAGGGCGTGGTATCCGCGGATCC 180
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     121 CGGGCAG-AGGCCTTGGACTGTGCCACAGCCCTCAACGAGGGCGTGGTATCCGCGGATCC 180


14186R-1.IR_full       181 GGGCGGCANCGGCGGTACGCCAAGCAGTGCGGGTCGCATCAGTGCCCAGAGCTCGGCGGA 240
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     181 GGGCGGCAGCGGCGGTACGCCAAGCAGTGCGGGTCGCATCAGTGCCCAGAGCTCGGCGGA 240


14186R-1.IR_full       241 CAGCATAGAGCTGGTGGGTTCNGCCCAGCCAGACGTCGCAGCAAACGGTGGTGCTGGTCA 300
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     241 CAGCATAGAGCTGGTGGGTTC-GCCCAGCCAGACGTCGCAGCAAACGGTGGTGCTGGTCA 300


14186R-1.IR_full       301 ACGGCCACGCCCCGCCGGGCCAGGAGGAGGGGGAGGAGGANGTCGCCACTGGGCGCAGGC 360
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
14186R-1.in silico     301 ACGGCCACGCCCCGCCGGGCCAGGAGGAGGGGGAGGAGGA-GTCGCCACTGGGCGCAGGC 360


14186R-1.IR_full       361 AATACCAGGGACTCACCGCCGCCGCCCAAGCAGAGCGATGGCAGTCGCAACTCATCCGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     361 AATACCAGGGACTCACCGCCGCCGCCCAAGCAGAGCGATGGCAGTCGCAACTCATCCGGC 420


14186R-1.IR_full       421 GATGCGATGAGTCTGCGGGAGACCCTGCAGCAACTACCGGCCACCCATCACCATCGGTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14186R-1.in silico     421 GATGCGATGAGTCTGCGGGAGACCCTGCAGCAACTACCGGCCACCCATCACCATCGGTCC 480


14186R-1.IR_full       481 AGGCGAACTCACTCACCTGCTGA 503
                           |||||||||||||||||||||||
14186R-1.in silico     481 AGGCGAACTCACTCACCTGCTGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140917.1  CG14186-RA (CG14186), mRNA 
0.41   NM_057629.3  CG4379-RA, transcript variant A (Pka-C1), mRNA 
0.41   NM_164866.1  CG4379-RB, transcript variant B (Pka-C1), mRNA 
0.41   NM_205950.1  CG4379-RC, transcript variant C (Pka-C1), mRNA 
0.2   18  35  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0.2   10  NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0.2   NM_134708.2  CG13949-RA (CG13949), mRNA 
0   16  23  38  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   16  23  38  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   10  11  32  NM_135975.2  CG31781-RB (CG31781), mRNA 
0   13  39  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   17  NM_176374.1  CG4761-RA (knrl), mRNA 
0   17  36  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   15  42  NM_167340.1  CG32648-RA (Pde9), mRNA 
0   13  23  NM_057406.3  CG6222-RA (su(s)), mRNA 
0   19  NM_135495.2  CG4778-RA (CG4778), mRNA 
0   18  35  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   12  18  NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
0   12  18  NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
0   10  25  NM_167309.1  CG32663-RA (CG32663), mRNA 
0   13  27  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   11  17  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
0   10  25  NM_141658.3  CG8301-RA (CG8301), mRNA 
0   10  14  NM_138057.1  CG13576-RA (CG13576), mRNA 
0   10  12  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0   15  NM_143222.1  CG14237-RA (CG14237), mRNA 
0   19  NM_134510.1  CG12703-RA (CG12703), mRNA 
0   15  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   14  NM_164653.1  CG31646-RA (CG31646), mRNA 
0   19  46  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.