National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1416R-4 
 Symbol CG1416  Full Name CG1416 
 CG No CG1416  Old CG No CG1416 
 Synonyms CG1416 
 Accession No (Link to NCBI) NM_136277.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCAAAGCGACATTGAGTGTG 
 Primer Seq. 3'
aatctagaggtaccTTTACAGCCGATGCCAGAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gGNAAAGCTG ACATTGAGTG TGCCGTGGAC TCCGTGGACA AATGCTCCGG GGAGGCCACC 
0061 GTGAACAATC GCAAGGGCAA GCTCATATTT TTCTACGAGT GGGAGCTGGT GCTCAAGTGG 
0121 TCTGGAAAGC TCCTAAAGAA CAGCAAGCTG ATCCACAAGG GCAAGTTAAC CATTCCCAAT 
0181 CTCTCCGAGG AGAACGAACT AGCCGACGTA GAGATCACGG TGACAATCGA CGAGTCCAAC 
0241 GACGAGTCGG AGACCCTGAA ACAGTTCATG TACAACGTGG GACGANGACC GCGTGCGGCA 
0301 GCAANCTGGC TTCCTACATC CGAGAGTTGA AGGAGGAGTA CTCCAAGAAC CTTATCCTAC 
0361 CAAAGAAGGG CGACGAGGCC GGAGCGGGAA ATACTGTGGC GAATTTTAAG GATGCCAACA 
0421 ATACCCGTAA TGCAGCCCAA AATATCGCTT TAAACTCCTC GGTGGCGGCT CCTAGGCTGA 
0481 AGAACTCTGG CATCGGCTGT AAA 
 in silico PCR Fragment
0001 GGCAAAGC-G ACATTGAGTG TGCCGTGGAC TCCGTGGACA AATGCTCCGG GGAGGCCACC 
0061 GTGAACAATC GCAAGGGCAA GCTCATATTT TTCTACGAGT GGGAGCTGGT GCTCAAGTGG 
0121 TCTGGAAAGC TCCTAAAGAA CAGCAAGCTG ATCCACAAGG GCAAGTTAAC CATTCCCAAT 
0181 CTCTCCGAGG AGAACGAACT AGCCGACGTA GAGATCACGG TGACAATCGA CGAGTCCAAC 
0241 GACGAGTCGG AGACCCTGAA ACAGTTCATG TACAACGTGG GACGA-GACC GCGTGCGGCA 
0301 GCAA-CTGGC TTCCTACATC CGAGAGTTGA AGGAGGAGTA CTCCAAGAAC CTTATCCTAC 
0361 CAAAGAAGGG CGACGAGGCC GGAGCGGGAA ATACTGTGGC GAATTTTAAG GATGCCAACA 
0421 ATACCCGTAA TGCAGCCCAA AATATCGCTT TAAACTCCTC GGTGGCGGCT CCTAGGCTGA 
0481 AGAACTCTGG CATCGGCTGT AAA 
 Assemble Data

1416R-4.IR_full       1   GGNAAAGCTGACATTGAGTGTGCCGTGGACTCCGTGGACAAATGCTCCGGGGAGGCCACC 60
                          || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     1   GGCAAAGC-GACATTGAGTGTGCCGTGGACTCCGTGGACAAATGCTCCGGGGAGGCCACC 60


1416R-4.IR_full       61  GTGAACAATCGCAAGGGCAAGCTCATATTTTTCTACGAGTGGGAGCTGGTGCTCAAGTGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     61  GTGAACAATCGCAAGGGCAAGCTCATATTTTTCTACGAGTGGGAGCTGGTGCTCAAGTGG 120


1416R-4.IR_full       121 TCTGGAAAGCTCCTAAAGAACAGCAAGCTGATCCACAAGGGCAAGTTAACCATTCCCAAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     121 TCTGGAAAGCTCCTAAAGAACAGCAAGCTGATCCACAAGGGCAAGTTAACCATTCCCAAT 180


1416R-4.IR_full       181 CTCTCCGAGGAGAACGAACTAGCCGACGTAGAGATCACGGTGACAATCGACGAGTCCAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     181 CTCTCCGAGGAGAACGAACTAGCCGACGTAGAGATCACGGTGACAATCGACGAGTCCAAC 240


1416R-4.IR_full       241 GACGAGTCGGAGACCCTGAAACAGTTCATGTACAACGTGGGACGANGACCGCGTGCGGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
1416R-4.in silico     241 GACGAGTCGGAGACCCTGAAACAGTTCATGTACAACGTGGGACGA-GACCGCGTGCGGCA 300


1416R-4.IR_full       301 GCAANCTGGCTTCCTACATCCGAGAGTTGAAGGAGGAGTACTCCAAGAACCTTATCCTAC 360
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     301 GCAA-CTGGCTTCCTACATCCGAGAGTTGAAGGAGGAGTACTCCAAGAACCTTATCCTAC 360


1416R-4.IR_full       361 CAAAGAAGGGCGACGAGGCCGGAGCGGGAAATACTGTGGCGAATTTTAAGGATGCCAACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     361 CAAAGAAGGGCGACGAGGCCGGAGCGGGAAATACTGTGGCGAATTTTAAGGATGCCAACA 420


1416R-4.IR_full       421 ATACCCGTAATGCAGCCCAAAATATCGCTTTAAACTCCTCGGTGGCGGCTCCTAGGCTGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1416R-4.in silico     421 ATACCCGTAATGCAGCCCAAAATATCGCTTTAAACTCCTCGGTGGCGGCTCCTAGGCTGA 480


1416R-4.IR_full       481 AGAACTCTGGCATCGGCTGTAAA 503
                          |||||||||||||||||||||||
1416R-4.in silico     481 AGAACTCTGGCATCGGCTGTAAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136277.2  CG1416-RA, transcript variant A (CG1416), mRNA 
100   482  NM_165398.1  CG1416-RB, transcript variant B (CG1416), mRNA 
100   482  NM_165399.1  CG1416-RC, transcript variant C (CG1416), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_143785.2  CG9762-RA (l(3)neo18), mRNA 
0   NM_142741.2  CG17843-RA (CG17843), mRNA 
0   NM_142746.1  CG6022-RA (CG6022), mRNA 
0   NM_132665.1  CG15753-RA (CG15753), mRNA 
0   NM_137832.1  CG4554-RA (CG4554), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_143713.2  CG2173-RA (Rs1), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_136863.2  CG8986-RA (CG8986), mRNA 
0   NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0   NM_133144.2  CG7893-RA, transcript variant A (vav), mRNA 
0   NM_134535.2  CG17068-RA (CG17068), mRNA 
0   NM_167226.1  CG32686-RB, transcript variant B (CG32686), mRNA 
0   NM_167227.1  CG32686-RA, transcript variant A (CG32686), mRNA 
0   NM_139627.1  CG1311-RA (CG1311), mRNA 
0   NM_142086.2  CG9649-RA (CG9649), mRNA 
0   NM_134967.2  CG3980-RB, transcript variant B (CG3980), mRNA 
0   NM_164563.2  CG3980-RA, transcript variant A (CG3980), mRNA 
0   NM_168661.1  CG4729-RB, transcript variant B (CG4729), mRNA 
0   NM_168662.1  CG4729-RC, transcript variant C (CG4729), mRNA 
0   NM_140631.1  CG4729-RA, transcript variant A (CG4729), mRNA 
0   NM_001032102.1  CG33679-RA (CG33679), mRNA 
0   NM_135644.2  CG4713-RA (CG4713), mRNA 
0   NM_135141.2  CG9135-RA, transcript variant A (CG9135), mRNA 
0   NM_164679.1  CG9135-RB, transcript variant B (CG9135), mRNA 
0   NM_142279.2  CG10311-RA (CG10311), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.