National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1416R-3 
 Symbol CG1416  Full Name CG1416 
 CG No CG1416  Old CG No CG1416 
 Synonyms CG1416 
 Accession No (Link to NCBI) NM_136277.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCAAAGC-GACATTGAGTGTGCCGTGGACTCCGTGGACAAATGCTCCGGGGAGGCCACC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGAACAATCGCAAGGGCAAGCTCATATTTTTCTACGAGTGGGAGCTGGTGCTCAAGTGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTGGAAAGCTCCTAAAGAACAGCAAGCTGATCCACAAGGGCAAGTTAACCATTCCCAAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTCTCCGAGGAGAACGAACTAGCCGACGTAGAGATCACGGTGACAATCGACGAGTCCAAC 240

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     241 GACGAGTCGGAGACCCTGAAACAGTTCATGTACAACGTGGGACGA-GACCGCGTGCGGCA 300

                          |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCAA-CTGGCTTCCTACATCCGAGAGTTGAAGGAGGAGTACTCCAAGAACCTTATCCTAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAAAGAAGGGCGACGAGGCCGGAGCGGGAAATACTGTGGCGAATTTTAAGGATGCCAACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATACCCGTAATGCAGCCCAAAATATCGCTTTAAACTCCTCGGTGGCGGCTCCTAGGCTGA 480

1416R-3.IR_full       481 AGAACTCTGGCATCGGCTGTAAA 503
                          ||||||||||||||||||||||| silico     481 AGAACTCTGGCATCGGCTGTAAA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136277.2  CG1416-RA, transcript variant A (CG1416), mRNA 
100   482  NM_165398.1  CG1416-RB, transcript variant B (CG1416), mRNA 
100   482  NM_165399.1  CG1416-RC, transcript variant C (CG1416), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_143785.2  CG9762-RA (l(3)neo18), mRNA 
0   NM_142741.2  CG17843-RA (CG17843), mRNA 
0   NM_142746.1  CG6022-RA (CG6022), mRNA 
0   NM_132665.1  CG15753-RA (CG15753), mRNA 
0   NM_137832.1  CG4554-RA (CG4554), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_143713.2  CG2173-RA (Rs1), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_136863.2  CG8986-RA (CG8986), mRNA 
0   NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0   NM_133144.2  CG7893-RA, transcript variant A (vav), mRNA 
0   NM_134535.2  CG17068-RA (CG17068), mRNA 
0   NM_167226.1  CG32686-RB, transcript variant B (CG32686), mRNA 
0   NM_167227.1  CG32686-RA, transcript variant A (CG32686), mRNA 
0   NM_139627.1  CG1311-RA (CG1311), mRNA 
0   NM_142086.2  CG9649-RA (CG9649), mRNA 
0   NM_134967.2  CG3980-RB, transcript variant B (CG3980), mRNA 
0   NM_164563.2  CG3980-RA, transcript variant A (CG3980), mRNA 
0   NM_168661.1  CG4729-RB, transcript variant B (CG4729), mRNA 
0   NM_168662.1  CG4729-RC, transcript variant C (CG4729), mRNA 
0   NM_140631.1  CG4729-RA, transcript variant A (CG4729), mRNA 
0   NM_001032102.1  CG33679-RA (CG33679), mRNA 
0   NM_135644.2  CG4713-RA (CG4713), mRNA 
0   NM_135141.2  CG9135-RA, transcript variant A (CG9135), mRNA 
0   NM_164679.1  CG9135-RB, transcript variant B (CG9135), mRNA 
0   NM_142279.2  CG10311-RA (CG10311), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.