National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14168R-1 
 Symbol CG14168  Full Name CG14168 
 CG No CG14168  Old CG No CG14168 
 Synonyms CG14168 
 Accession No (Link to NCBI) NM_140101.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGATTTGATAATGTGCCCTGG 
 Primer Seq. 3'
aatctagaggtaccTCTTCCGAATGCACTTCCGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGATTTGATA ATGTGCCCTG GGGCTTTCGC CTGGTGNGGC GGGGCGGACT ACGATTATCC 
0061 GCTGACGGTG GTTAAGGGTG ACCGAGGGCA GCATTGCTGA CNGAGGCTGG ACTGCGGGTC 
0121 GAGGATATCA TCGTGCGCAT CAATGACACG GCTGCCACGC CCCNTTACCC ANCGACGAGG 
0181 CCCACCGCCT CATTATGGGC AGTGGAAGCG TCTTCTACTT TGGCGTCTAT CGGGAGAACG 
0241 AGGAGGACGC TTACGAGTGC CTAAAGAAGT TTCCCACGAG CGAGGGTTCG TTGACCAAGT 
0301 CACCAATGCC GACCATTTCA CCGTCGCCGA CTCCATCGCT GTCCCAGCTG ACGGAAACCA 
0361 CAAATGCCCG TACTCCGGAA CCGGAGCCAT TCGTTCCGCT ACCCCGGGAA CTCGCTGTTG 
0421 CGACTATGGC GGCTCCTGCT GTGGAAGTGG ACGTGGATGN CCNGGCGGAA TGTCGCCAAC 
0481 CCATGTCGGA AGTGCATTCG GAAGA 
 in silico PCR Fragment
0001 CGATTTGATA ATGTGCCCTG GGGCTTTCGC CTGGTG-GGC GGGGCGGACT ACGATTATCC 
0061 GCTGACGGTG GTTAA-GGTG ACCGAGGGCA GCATTGCTGA C-GAGGCTGG ACTGCGGGTC 
0121 GAGGATATCA TCGTGCGCAT CAATGACACG GCTGCCACGC CCC-TTACCC A-CGACGAGG 
0181 CCCACCGCCT CATTATGGGC AGTGGAAGCG TCTTCTATTT TGGCGTCTAC CGGGAGAACG 
0241 AGGAGGACGC TTACGAGTGC CTAAAGAAGT TTCCCACGAG CGAGGGTTCG TTGACCAAGT 
0301 CACCAATGCC GACCATTTCA CCGTCGCCGA CTCCATCGCT GTCCCAGCTG ACGGAAACCA 
0361 CAAATGCCCG TACTCCGGAA CCGGAGCCAT TCGTTCCGCT ACCCCGGGAA CTCGCTGCTG 
0421 CGACTATGGC GGCTCCTGCT GTGGAAGTGG ACGTGGATGT CCTGGCGGAA TGTCGCCAAC 
0481 CCATGTCGGA AGTGCATTCG GAAGA 
 Assemble Data

14168R-1.IR_full       1   CGATTTGATAATGTGCCCTGGGGCTTTCGCCTGGTGNGGCGGGGCGGACTACGATTATCC 60
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
14168R-1.in silico     1   CGATTTGATAATGTGCCCTGGGGCTTTCGCCTGGTG-GGCGGGGCGGACTACGATTATCC 60


14168R-1.IR_full       61  GCTGACGGTGGTTAAGGGTGACCGAGGGCAGCATTGCTGACNGAGGCTGGACTGCGGGTC 120
                           ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||
14168R-1.in silico     61  GCTGACGGTGGTTAA-GGTGACCGAGGGCAGCATTGCTGAC-GAGGCTGGACTGCGGGTC 120


14168R-1.IR_full       121 GAGGATATCATCGTGCGCATCAATGACACGGCTGCCACGCCCCNTTACCCANCGACGAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||
14168R-1.in silico     121 GAGGATATCATCGTGCGCATCAATGACACGGCTGCCACGCCCC-TTACCCA-CGACGAGG 180


14168R-1.IR_full       181 CCCACCGCCTCATTATGGGCAGTGGAAGCGTCTTCTACTTTGGCGTCTATCGGGAGAACG 240
                           ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||
14168R-1.in silico     181 CCCACCGCCTCATTATGGGCAGTGGAAGCGTCTTCTATTTTGGCGTCTACCGGGAGAACG 240


14168R-1.IR_full       241 AGGAGGACGCTTACGAGTGCCTAAAGAAGTTTCCCACGAGCGAGGGTTCGTTGACCAAGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14168R-1.in silico     241 AGGAGGACGCTTACGAGTGCCTAAAGAAGTTTCCCACGAGCGAGGGTTCGTTGACCAAGT 300


14168R-1.IR_full       301 CACCAATGCCGACCATTTCACCGTCGCCGACTCCATCGCTGTCCCAGCTGACGGAAACCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14168R-1.in silico     301 CACCAATGCCGACCATTTCACCGTCGCCGACTCCATCGCTGTCCCAGCTGACGGAAACCA 360


14168R-1.IR_full       361 CAAATGCCCGTACTCCGGAACCGGAGCCATTCGTTCCGCTACCCCGGGAACTCGCTGTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
14168R-1.in silico     361 CAAATGCCCGTACTCCGGAACCGGAGCCATTCGTTCCGCTACCCCGGGAACTCGCTGCTG 420


14168R-1.IR_full       421 CGACTATGGCGGCTCCTGCTGTGGAAGTGGACGTGGATGNCCNGGCGGAATGTCGCCAAC 480
                           ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||
14168R-1.in silico     421 CGACTATGGCGGCTCCTGCTGTGGAAGTGGACGTGGATGTCCTGGCGGAATGTCGCCAAC 480


14168R-1.IR_full       481 CCATGTCGGAAGTGCATTCGGAAGA 505
                           |||||||||||||||||||||||||
14168R-1.in silico     481 CCATGTCGGAAGTGCATTCGGAAGA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140101.1  CG14168-RA (CG14168), mRNA 
0   NM_079168.2  CG1262-RA (Acp62F), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
0   NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
0   NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
0   NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
0   NM_001042809.1  CG15720-RB, transcript variant B (CG15720), mRNA 
0   NM_132620.1  CG15720-RA, transcript variant A (CG15720), mRNA 
0   NM_136542.1  CG30361-RA, transcript variant A (mXr), mRNA 
0   NM_137992.1  CG5549-RA (CG5549), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_144282.1  CG12650-RB (CG12650), mRNA 
0   NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
0   NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
0   NM_131920.2  CG6379-RA (CG6379), mRNA 
0   NM_134987.1  CG15431-RA (CG15431), mRNA 
0   NM_143270.2  CG6265-RA, transcript variant A (Nep5), mRNA 
0   NM_170307.1  CG6265-RB, transcript variant B (Nep5), mRNA 
0   NM_133144.2  CG7893-RA, transcript variant A (vav), mRNA 
0   NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0   NM_137510.2  CG30122-RB (CG30122), mRNA 
0   12  NM_167663.1  CG3917-RB, transcript variant B (Grip84), mRNA 
0   12  NM_078685.2  CG3917-RC, transcript variant C (Grip84), mRNA 
0   12  NM_167662.1  CG3917-RA, transcript variant A (Grip84), mRNA 
0   NM_138105.1  CG13594-RA (CG13594), mRNA 
0   NM_057593.3  CG14266-RA (ng2), mRNA 
0   11  NM_134530.2  CG9576-RA (CG9576), mRNA 
0   NM_167681.1  CG18809-RA, transcript variant A (CG18809), mRNA 
0   NM_132073.1  CG14445-RA (CG14445), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.