National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14133Ra-3 
 Symbol Pldn  Full Name Pallidin 
 CG No CG14133  Old CG No CG14133 
 Synonyms CG14133,NP_648494,Pallidin,pallidin,Pldn,pldn,Pallidin ortholog 
 Accession No (Link to NCBI) NM_140237.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCAGTCTAGCCGCTTTA 
 Primer Seq. 3'
aatctagaggtaccTGCCAATGAGCGACTCCTCGT 
 Predicted Fragment Size
355 
 IR fragment full Seq
0001 ATGGCCAGTC TAGCCGCTTT ACAGTTGTCC GCTGGCGTCC TGCAAATAGC GGAGCCTCCA 
0061 CTAAACCATG TGCGCACCCA GCTTAGGGAA TTGATCGGTA GGCAGAACAA AACATACATC 
0121 GATTTGTCCA AGGAGAAATA TAAACTGGAC TGCAGCGAAG TGGCCAGGCT GAATGATATG 
0181 ATGAGCGATG TAAAGCGATA CAAAGATAAG CTAACAAAAA TCAAGAAGGA AATGCAGGGC 
0241 GTCTATCAGC GCACCAAAGA GTTAAAGAAA CGAGCNCTGC TAACGAGGCG NCCTGNCAAG 
0301 CAGCGTGACT ACCAGCGGAA ACTCGAGAGG CTACAGCACG AGGAGTCGCT CATTGGCA 
 in silico PCR Fragment
0001 ATGGCCAGTC TAGCCGCTTT ACAGTTGTCC GCTGGCGTCC TGCAAATAGC GGAGCCTCCA 
0061 CTAAACCATG TGCGCACCCA GCTTAGGGAA TTGATCGGTA GGCAGAACAA AACATACATC 
0121 GATTTGTCCA AGGAGAAATA TAAACTGGAC TGCAGCGAAG TGGCCAGGCT GAATGATATG 
0181 ATGAGCGATG TAAAGCGATA CAAAGATAAG CTAACAAAAA TCAAGAAGGA AATGCAGGGC 
0241 GTCTATCAGC GCACCAAAGA GTTAAAGAAA CGAGCCGCTA ACGTGGCGGC CTGCAAGCAG 
0301 CGTGACTACC AGCGGAAACT CGAGAGGCTA CAGCACGAGG AGTCGCTCAT TGGCA 
 Assemble Data

14133Ra-3.IR full       1   ATGGCCAGTCTAGCCGCTTTACAGTTGTCCGCTGGCGTCCTGCAAATAGCGGAGCCTCCA 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14133Ra-3.in silico     1   ATGGCCAGTCTAGCCGCTTTACAGTTGTCCGCTGGCGTCCTGCAAATAGCGGAGCCTCCA 60


14133Ra-3.IR full       61  CTAAACCATGTGCGCACCCAGCTTAGGGAATTGATCGGTAGGCAGAACAAAACATACATC 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14133Ra-3.in silico     61  CTAAACCATGTGCGCACCCAGCTTAGGGAATTGATCGGTAGGCAGAACAAAACATACATC 120


14133Ra-3.IR full       121 GATTTGTCCAAGGAGAAATATAAACTGGACTGCAGCGAAGTGGCCAGGCTGAATGATATG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14133Ra-3.in silico     121 GATTTGTCCAAGGAGAAATATAAACTGGACTGCAGCGAAGTGGCCAGGCTGAATGATATG 180


14133Ra-3.IR full       181 ATGAGCGATGTAAAGCGATACAAAGATAAGCTAACAAAAATCAAGAAGGAAATGCAGGGC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14133Ra-3.in silico     181 ATGAGCGATGTAAAGCGATACAAAGATAAGCTAACAAAAATCAAGAAGGAAATGCAGGGC 240


14133Ra-3.IR full       241 GTCTATCAGCGCACCAAAGAGTTAAAGAAACGAGCNCTGCTAACGAGGCGNCCTGNCAAG 300
                            |||||||||||||||||||||||||||||||||||   ||||||| |||| ||||  |||
14133Ra-3.in silico     241 GTCTATCAGCGCACCAAAGAGTTAAAGAAACGAGCC--GCTAACGTGGCGGCCTGC-AAG 300


14133Ra-3.IR full       301 CAGCGTGACTACCAGCGGAAACTCGAGAGGCTACAGCACGAGGAGTCGCTCATTGGCA 358
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14133Ra-3.in silico     301 CAGCGTGACTACCAGCGGAAACTCGAGAGGCTACAGCACGAGGAGTCGCTCATTGGCA 358

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   337  NM_140237.1  CG14133-RA (CG14133), mRNA 
0.29   NM_206649.1  CG2258-RB, transcript variant B (CG2258), mRNA 
0.29   NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
0.29   NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_132426.1  CG15209-RA (CG15209), mRNA 
0   NM_079345.2  CG4994-RA, transcript variant A (Mpcp), mRNA 
0   NM_078691.2  CG12532-RA (Bap), mRNA 
0   NM_170509.1  CG2246-RF, transcript variant F (CG2246), mRNA 
0   NM_143556.2  CG2246-RE, transcript variant E (CG2246), mRNA 
0   NM_137543.2  CG15106-RA (Jheh3), mRNA 
0   NM_170508.1  CG2246-RD, transcript variant D (CG2246), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   NM_170507.1  CG2246-RB, transcript variant B (CG2246), mRNA 
0   NM_170510.1  CG2246-RA, transcript variant A (CG2246), mRNA 
0   NM_170511.1  CG2246-RC, transcript variant C (CG2246), mRNA 
0   NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
0   NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
0   NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
0   NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
0   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0   NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
0   NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0   NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0   NM_167491.1  CG3525-RC, transcript variant C (eas), mRNA 
0   NM_132511.1  CG2444-RA (CG2444), mRNA 
0   NM_001043127.1  CG34121-RA (CG34121), mRNA 
0   NM_176741.1  CG3525-RE, transcript variant E (eas), mRNA 
0   NM_167490.1  CG3525-RB, transcript variant B (eas), mRNA 
0   NM_078640.2  CG3525-RA, transcript variant A (eas), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.