National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14103R-2 
 Symbol CG34116  Full Name CG34116 
 CG No CG34116  Old CG No CG14103 
 Synonyms CG14103, CG34116 
 Accession No (Link to NCBI) NM_001043151.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CACGAGAAAATTGAAACCGGCGTCTACCAATTGGCTGTTAATGACAAAAGCACACGGAGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACTGTGTGGCGGGTGTATCGCAAGATCAAGAAGGACGATGGTAGCTTTCTGGAGCACGTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTGTTCTGCATCGGCTGCAGGAGCATTATGTCCTTCACCCACAAATCCACAACGAACCTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGCGTCACCGGTGTCACCTGCAGTATCTCAAGAAACAGGCATTCTGCTGCTACAATTCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGGCGAATCCAACGACAGAAAGGAGGAGACGGACCAGGAGCATCATGAGGAACATGAT 300

                           ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     301 GACCAACAATCCATGTCGGATGA-GTTGGAAACAAAACCCTCTCCTGCCGATGTTGCCGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTTTGTGGGGGAAGCGGTCAGCGGCGGAGATTCCACTGCAGCTTCAGCCCGTATTCCGGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     421 CATTCCCGAGATCGCGCTACCACTCGACGCAAGTGGGGTCGAGGAGTCCAATGTTTATGC 480

14103R-2.IR_full       481 ACAGACCTGGTCCCTTGAGTA 501
                           ||||||||||||||||||||| silico     481 ACAGACCTGGTCCCTTGAGTA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043151.1  CG34116-RA (CG34116), mRNA 
100   482  NM_140893.2  CG15881-RB, transcript variant B (CG15881), mRNA 
0   NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_057316.3  CG5581-RA (Ote), mRNA 
0   NM_141134.1  CG11440-RA (CG11440), mRNA 
0   NM_166999.2  CG32790-RA (CG32790), mRNA 
0   NM_167904.1  CG17248-RC, transcript variant C (n-syb), mRNA 
0   NM_167906.1  CG17248-RD, transcript variant D (n-syb), mRNA 
0   NM_167905.1  CG17248-RB, transcript variant B (n-syb), mRNA 
0   NM_206234.1  CG17248-RE, transcript variant E (n-syb), mRNA 
0   NM_057710.3  CG17248-RA, transcript variant A (n-syb), mRNA 
0   NM_165840.1  CG30034-RA (CG30034), mRNA 
0   NM_137130.2  CG10131-RA (CG10131), mRNA 
0   NM_130596.2  CG14804-RA (CG14804), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_139973.1  CG6694-RA (CG6694), mRNA 
0   NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
0   NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176114.1  CG2049-RE, transcript variant E (Pkn), mRNA 
0   NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_144032.1  CG14580-RA (CG14580), mRNA 
0   NM_143019.2  CG6695-RA, transcript variant A (CG6695), mRNA 
0   NM_206565.1  CG6695-RB, transcript variant B (CG6695), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.