National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14103R-1 
 Symbol CG34116  Full Name CG34116 
 CG No CG34116  Old CG No CG14103 
 Synonyms CG14103, CG34116 
 Accession No (Link to NCBI) NM_001043151.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACGAGAAAATTGAAACCGGC 
 Primer Seq. 3'
aatctagaggtaccTACTCAAGGGACCAGGTCTGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 cACGAGAAAA TTGAAACCGG CGTCTACCAA TTGGCTGTTA ATGACAAAAG CACACGGAGC 
0061 ACTGTGTGGC GGGTGTATCG CAAGATCAAG AAGGACGATG GTAGCTTTCT GGAGCACGTA 
0121 CTGTTCTGCA TCGGCTGCAG GAGCATTATG TCCTTCACCC ACAAATCCAC AACGAACCTG 
0181 AGGCGTCACC GGTGTCACCT GCAGTATCTC AAGAAACAGG CATTCTGCTG CTACAATTCC 
0241 AAGGGCGAAT CCAACGACAG AAAGGAGGAG ACGGACCAGG AGCATCATGA GGAACATGAT 
0301 GACCAACAAT CCATGTCGGA TGAGGTTGGA AACAAAACCC TCTCCTGCCG ATGTTGCCGC 
0361 CTTTGTGGGG GAAGCGGTCA GCGGCGGAGA TTCCACTGCA GCTTCAGCCC GTATTCCGGA 
0421 CATTCCCGAG ATCGCGCTAC CACTCGACGC AAGTGGGGTC GAGGAGTCCA GTGTTTATGC 
0481 ACAGACCTGG TCCCTTGAGT A 
 in silico PCR Fragment
0001 CACGAGAAAA TTGAAACCGG CGTCTACCAA TTGGCTGTTA ATGACAAAAG CACACGGAGC 
0061 ACTGTGTGGC GGGTGTATCG CAAGATCAAG AAGGACGATG GTAGCTTTCT GGAGCACGTA 
0121 CTGTTCTGCA TCGGCTGCAG GAGCATTATG TCCTTCACCC ACAAATCCAC AACGAACCTG 
0181 AGGCGTCACC GGTGTCACCT GCAGTATCTC AAGAAACAGG CATTCTGCTG CTACAATTCC 
0241 AAGGGCGAAT CCAACGACAG AAAGGAGGAG ACGGACCAGG AGCATCATGA GGAACATGAT 
0301 GACCAACAAT CCATGTCGGA TGA-GTTGGA AACAAAACCC TCTCCTGCCG ATGTTGCCGC 
0361 CTTTGTGGGG GAAGCGGTCA GCGGCGGAGA TTCCACTGCA GCTTCAGCCC GTATTCCGGA 
0421 CATTCCCGAG ATCGCGCTAC CACTCGACGC AAGTGGGGTC GAGGAGTCCA ATGTTTATGC 
0481 ACAGACCTGG TCCCTTGAGT A 
 Assemble Data

14103R-1.IR_full       1   CACGAGAAAATTGAAACCGGCGTCTACCAATTGGCTGTTAATGACAAAAGCACACGGAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     1   CACGAGAAAATTGAAACCGGCGTCTACCAATTGGCTGTTAATGACAAAAGCACACGGAGC 60


14103R-1.IR_full       61  ACTGTGTGGCGGGTGTATCGCAAGATCAAGAAGGACGATGGTAGCTTTCTGGAGCACGTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     61  ACTGTGTGGCGGGTGTATCGCAAGATCAAGAAGGACGATGGTAGCTTTCTGGAGCACGTA 120


14103R-1.IR_full       121 CTGTTCTGCATCGGCTGCAGGAGCATTATGTCCTTCACCCACAAATCCACAACGAACCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     121 CTGTTCTGCATCGGCTGCAGGAGCATTATGTCCTTCACCCACAAATCCACAACGAACCTG 180


14103R-1.IR_full       181 AGGCGTCACCGGTGTCACCTGCAGTATCTCAAGAAACAGGCATTCTGCTGCTACAATTCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     181 AGGCGTCACCGGTGTCACCTGCAGTATCTCAAGAAACAGGCATTCTGCTGCTACAATTCC 240


14103R-1.IR_full       241 AAGGGCGAATCCAACGACAGAAAGGAGGAGACGGACCAGGAGCATCATGAGGAACATGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     241 AAGGGCGAATCCAACGACAGAAAGGAGGAGACGGACCAGGAGCATCATGAGGAACATGAT 300


14103R-1.IR_full       301 GACCAACAATCCATGTCGGATGAGGTTGGAAACAAAACCCTCTCCTGCCGATGTTGCCGC 360
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
14103R-1.in silico     301 GACCAACAATCCATGTCGGATGA-GTTGGAAACAAAACCCTCTCCTGCCGATGTTGCCGC 360


14103R-1.IR_full       361 CTTTGTGGGGGAAGCGGTCAGCGGCGGAGATTCCACTGCAGCTTCAGCCCGTATTCCGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14103R-1.in silico     361 CTTTGTGGGGGAAGCGGTCAGCGGCGGAGATTCCACTGCAGCTTCAGCCCGTATTCCGGA 420


14103R-1.IR_full       421 CATTCCCGAGATCGCGCTACCACTCGACGCAAGTGGGGTCGAGGAGTCCAGTGTTTATGC 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
14103R-1.in silico     421 CATTCCCGAGATCGCGCTACCACTCGACGCAAGTGGGGTCGAGGAGTCCAATGTTTATGC 480


14103R-1.IR_full       481 ACAGACCTGGTCCCTTGAGTA 501
                           |||||||||||||||||||||
14103R-1.in silico     481 ACAGACCTGGTCCCTTGAGTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043151.1  CG34116-RA (CG34116), mRNA 
100   482  NM_140893.2  CG15881-RB, transcript variant B (CG15881), mRNA 
0   NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_057316.3  CG5581-RA (Ote), mRNA 
0   NM_141134.1  CG11440-RA (CG11440), mRNA 
0   NM_166999.2  CG32790-RA (CG32790), mRNA 
0   NM_167904.1  CG17248-RC, transcript variant C (n-syb), mRNA 
0   NM_167906.1  CG17248-RD, transcript variant D (n-syb), mRNA 
0   NM_167905.1  CG17248-RB, transcript variant B (n-syb), mRNA 
0   NM_206234.1  CG17248-RE, transcript variant E (n-syb), mRNA 
0   NM_057710.3  CG17248-RA, transcript variant A (n-syb), mRNA 
0   NM_165840.1  CG30034-RA (CG30034), mRNA 
0   NM_137130.2  CG10131-RA (CG10131), mRNA 
0   NM_130596.2  CG14804-RA (CG14804), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_139973.1  CG6694-RA (CG6694), mRNA 
0   NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
0   NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176114.1  CG2049-RE, transcript variant E (Pkn), mRNA 
0   NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_144032.1  CG14580-RA (CG14580), mRNA 
0   NM_143019.2  CG6695-RA, transcript variant A (CG6695), mRNA 
0   NM_206565.1  CG6695-RB, transcript variant B (CG6695), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.