National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14102R-1 
 Symbol CG14102  Full Name CG14102 
 CG No CG14102  Old CG No CG14102 
 Synonyms CG14102 
 Accession No (Link to NCBI) NM_140890.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal, female lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGGATTAGGCTGCCCCTTC 
 Primer Seq. 3'
aatctagaggtaccAGCTGTGCAGATCTGGCATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGGGAATTA GGCTGCCCCT TCTCCTTCCT GGTCGGAAGA CCGCAGAGTA TGAGTGGGGG 
0061 ACCCGGTTTC CTGGATCTCA ACTACGACTG CTACCATCAG ATATTTTCAT ATATAAATGT 
0121 GCTGGAGGAC CAGCTAAATC TGGGCCGGGC CCATCCACTA TTCCAGGTTG TACTGACGGA 
0181 CATTTTGCGA ACGCGCCACA AAAAAATCAA TGTGCGGCTT CTGAAAACCA TTCCGGACTG 
0241 GGAGTTCCTG CTGCAGCTGT GCGGTTCCGA AGTGTCCAGG TGCGAAGTGC CCCATGGTAG 
0301 CTGGGATGAG CCGTTTACCT ACCCCTTTCT GGGGCTCCTG GGACGGCACT GCCCCAAACT 
0361 GCGACAGGCA GTCATCATAT TTATGCACGC CGTTACAGAG TCGCCGCCGA AAAGTGGGGA 
0421 CAGGGGCCAC ATCATGCAGC TCCTCCTGGA GCTACCCAGT CTAACCAATC TCACTCTGAT 
0481 CGATGCCAGA TCTGcACAGC T 
 in silico PCR Fragment
0001 CTGGG-ATTA GGCTGCCCCT TCTCCTTCCT GGTCGGAAGA CCGCAGAGTA TGAGTGGGGG 
0061 ACCCGGTTTC CTGGATCTCA ACTACGACTG CTACCATCAG ATATTTTCAT ATATAAATGT 
0121 GCTGGAGGAC CAGCTAAATC TGGGCCGGGC CCATCCACTA TTCCAGGTTG TACTGACGGA 
0181 CATTTTGCGA ACGCGCCACA AAAAAATCAA TGTGCGGCTT CTGAAAACCA TTCCGGACTG 
0241 GGAGTTCCTG CTGCAGCTGT GCGGTTCCGA AGTGTCCAGG TGCGAAGTGC CCCATGGTAG 
0301 CTGGGATGAG CCGTTTACCT ACCCCTTTCT GGGGCTCCTG GGACGGCACT GCCCCAAACT 
0361 GCGACAGGCA GTCATCATAT TTATGCACGC CGTTACAGAG TCGCCGCCGA AAAGTGGGGA 
0421 CAGGGGCCAC ATCATGCAGC TCCTCCTGGA GCTACCCAGT CTAACCAATC TCACTCTGAT 
0481 CGATGCCAGA TCTGCACAGC T 
 Assemble Data

14102R-1.IR_full       1   CTGGGAATTAGGCTGCCCCTTCTCCTTCCTGGTCGGAAGACCGCAGAGTATGAGTGGGGG 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     1   CTGGG-ATTAGGCTGCCCCTTCTCCTTCCTGGTCGGAAGACCGCAGAGTATGAGTGGGGG 60


14102R-1.IR_full       61  ACCCGGTTTCCTGGATCTCAACTACGACTGCTACCATCAGATATTTTCATATATAAATGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     61  ACCCGGTTTCCTGGATCTCAACTACGACTGCTACCATCAGATATTTTCATATATAAATGT 120


14102R-1.IR_full       121 GCTGGAGGACCAGCTAAATCTGGGCCGGGCCCATCCACTATTCCAGGTTGTACTGACGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     121 GCTGGAGGACCAGCTAAATCTGGGCCGGGCCCATCCACTATTCCAGGTTGTACTGACGGA 180


14102R-1.IR_full       181 CATTTTGCGAACGCGCCACAAAAAAATCAATGTGCGGCTTCTGAAAACCATTCCGGACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     181 CATTTTGCGAACGCGCCACAAAAAAATCAATGTGCGGCTTCTGAAAACCATTCCGGACTG 240


14102R-1.IR_full       241 GGAGTTCCTGCTGCAGCTGTGCGGTTCCGAAGTGTCCAGGTGCGAAGTGCCCCATGGTAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     241 GGAGTTCCTGCTGCAGCTGTGCGGTTCCGAAGTGTCCAGGTGCGAAGTGCCCCATGGTAG 300


14102R-1.IR_full       301 CTGGGATGAGCCGTTTACCTACCCCTTTCTGGGGCTCCTGGGACGGCACTGCCCCAAACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     301 CTGGGATGAGCCGTTTACCTACCCCTTTCTGGGGCTCCTGGGACGGCACTGCCCCAAACT 360


14102R-1.IR_full       361 GCGACAGGCAGTCATCATATTTATGCACGCCGTTACAGAGTCGCCGCCGAAAAGTGGGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     361 GCGACAGGCAGTCATCATATTTATGCACGCCGTTACAGAGTCGCCGCCGAAAAGTGGGGA 420


14102R-1.IR_full       421 CAGGGGCCACATCATGCAGCTCCTCCTGGAGCTACCCAGTCTAACCAATCTCACTCTGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14102R-1.in silico     421 CAGGGGCCACATCATGCAGCTCCTCCTGGAGCTACCCAGTCTAACCAATCTCACTCTGAT 480


14102R-1.IR_full       481 CGATGCCAGATCTGCACAGCT 501
                           |||||||||||||||||||||
14102R-1.in silico     481 CGATGCCAGATCTGCACAGCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140890.2  CG14102-RA (CG14102), mRNA 
0.2   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0.2   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0.2   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_169584.1  CG31330-RA (CG31330), mRNA 
0   NM_079117.2  CG3385-RA (nvy), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   NM_136438.2  CG11141-RB, transcript variant B (CG11141), mRNA 
0   NM_165525.1  CG11141-RA, transcript variant A (CG11141), mRNA 
0   NM_142229.2  CG4525-RA (CG4525), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_136244.2  CG9256-RB, transcript variant B (Nhe2), mRNA 
0   NM_165355.1  CG9256-RA, transcript variant A (Nhe2), mRNA 
0   NM_139501.2  CG2114-RA (FR), mRNA 
0   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_133039.3  CG7122-RA, transcript variant A (RhoGAP16F), mRNA 
0   NM_132552.2  CG1488-RB, transcript variant B (Cyp311a1), mRNA 
0   NM_167317.1  CG1488-RA, transcript variant A (Cyp311a1), mRNA 
0   NM_135730.1  CG17031-RA (ref2), mRNA 
0   NM_168551.1  CG32130-RA, transcript variant A (stv), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 
0   NM_168552.1  CG32130-RC, transcript variant C (stv), mRNA 
0   NM_168553.1  CG32130-RB, transcript variant B (stv), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   10  NM_135722.2  CG6388-RA (CG6388), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.