National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14087Ra-1 
 Symbol ms(3)76Ba  Full Name male sterile (3) 76Ba 
 CG No CG14087  Old CG No CG14087 
 Synonyms CG14087 
 Accession No (Link to NCBI) NM_140852.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCACGACCTTCGATGTTT 
 Primer Seq. 3'
aatctagaggtaccGGCGATGGCGTATCTATGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCCACGAC CTTCGATGTT TGATTCAGAT TCAGATGAGT GCGAAGATCT TGAGTTTCTT 
0061 AATACTCGTA CGATCCGCGA TGACAAGGGG AACAACCGTA AGAGGAAGAG CACAGACACC 
0121 ATCGACAAGC AGGATGAATT CCAGGAATAT AATAACCATA CCTCCTCCAG CGCTTTTCCA 
0181 ATAGTAAAGC AACTATTATG CCGACGTGAC CCAAAGCCGC TGCCCACCAA GTTCCGTGCT 
0241 GGTAAGGTTG TTATGGACTT TGGCCCCGAC GAACATGCGG ATCCCATGAA AGTCGTCTAC 
0301 GAAGACAGTC CAATGAAACC TCCAAAGACA TCGAGGATTG CCAAGACCCG ACGATTCCCT 
0361 AAAGAGGCAA TAACATTTCC ANCTAAACTC CAAGATGTTT CAAGAGCCCC CGTCTATATA 
0421 GAACTAAATC TTCCAATGGA TTCACTTTGG TTGTTTGATC GCCGTTTTCG ACCGATGTCA 
0481 CCCATTTCCA GGAGCTTTGT GGATGATATT GACATAGATA CGCCATNNNC  
 in silico PCR Fragment
0001 ATGCCACGAC CTTCGATGTT TGATTCAGAT TCAGATGAGT GCGAAGATCT TGAGTTTCTT 
0061 AATACTCGTA CGATCCGCGA TGACAAGGGG AACAACCGTA AGAGGAAGAG CACAGACACC 
0121 ATCGACAAGC AGGATGAATT CCAGGAATAT AATAACCATA CCTCCTCCAG TAGACGTGAC 
0181 CCAAAGCCGC TGCCCACCAA GTTCCGTGCT GGTAAGGTTG TTATGGACTT TGGCCCCGAC 
0241 GAACATGCGG ATCCCATGAA AGTCGTCTAC GAAGACAGTC CAATGAAACC TCCAAAGACA 
0301 TCGAGGATTG CCAAGACCCG ACGATTCCCT AAAGAGGCAA TAACATTTCC AACTAAACTC 
0361 CAAGATGTTT CAAGAGCCCC CGTCTATATA GAACTAAATC TTCCAATGGA TTCACTTTGG 
0421 TTGTTTGATC GCCGTTTTCG ACCGATGTCA CCCATTTCCA GGAGCTTTGT GGATGATATT 
0481 GACATAGATA CGCCATCGCC  
 Assemble Data

14087Ra-1.IR full       1   ATGCCACGACCTTCGATGTTTGATTCAGATTCAGATGAGTGCGAAGATCTTGAGTTTCTT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     1   ATGCCACGACCTTCGATGTTTGATTCAGATTCAGATGAGTGCGAAGATCTTGAGTTTCTT 60


14087Ra-1.IR full       61  AATACTCGTACGATCCGCGATGACAAGGGGAACAACCGTAAGAGGAAGAGCACAGACACC 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     61  AATACTCGTACGATCCGCGATGACAAGGGGAACAACCGTAAGAGGAAGAGCACAGACACC 120


14087Ra-1.IR full       121 ATCGACAAGCAGGATGAATTCCAGGAATATAATAACCATACCTCCTCCAGCGCTTTTCCA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||          
14087Ra-1.in silico     121 ATCGACAAGCAGGATGAATTCCAGGAATATAATAACCATACCTCCTCCAGTA-------- 180


14087Ra-1.IR full       181 ATAGTAAAGCAACTATTATGCCGACGTGACCCAAAGCCGCTGCCCACCAAGTTCCGTGCT 240
                                                  ||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     181 ----------------------GACGTGACCCAAAGCCGCTGCCCACCAAGTTCCGTGCT 240


14087Ra-1.IR full       241 GGTAAGGTTGTTATGGACTTTGGCCCCGACGAACATGCGGATCCCATGAAAGTCGTCTAC 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     241 GGTAAGGTTGTTATGGACTTTGGCCCCGACGAACATGCGGATCCCATGAAAGTCGTCTAC 300


14087Ra-1.IR full       301 GAAGACAGTCCAATGAAACCTCCAAAGACATCGAGGATTGCCAAGACCCGACGATTCCCT 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     301 GAAGACAGTCCAATGAAACCTCCAAAGACATCGAGGATTGCCAAGACCCGACGATTCCCT 360


14087Ra-1.IR full       361 AAAGAGGCAATAACATTTCCANCTAAACTCCAAGATGTTTCAAGAGCCCCCGTCTATATA 420
                            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     361 AAAGAGGCAATAACATTTCCAACTAAACTCCAAGATGTTTCAAGAGCCCCCGTCTATATA 420


14087Ra-1.IR full       421 GAACTAAATCTTCCAATGGATTCACTTTGGTTGTTTGATCGCCGTTTTCGACCGATGTCA 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14087Ra-1.in silico     421 GAACTAAATCTTCCAATGGATTCACTTTGGTTGTTTGATCGCCGTTTTCGACCGATGTCA 480


14087Ra-1.IR full       481 CCCATTTCCAGGAGCTTTGTGGATGATATTGACATAGATACGCCATNNNC 530
                            ||||||||||||||||||||||||||||||||||||||||||||||   |
14087Ra-1.in silico     481 CCCATTTCCAGGAGCTTTGTGGATGATATTGACATAGATACGCCATCGCC 530

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140852.1  CG14087-RA (CG14087), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
0   NM_137707.2  CG30388-RA (Magi), mRNA 
0   NM_136011.2  CG7527-RA, transcript variant A (CadN2), mRNA 
0   NM_001042903.1  CG7527-RB, transcript variant B (CadN2), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_079750.3  CG5436-RA (Hsp68), mRNA 
0   NM_164975.2  CG14935-RB, transcript variant B (CG14935), mRNA 
0   NM_135679.3  CG14935-RA, transcript variant A (CG14935), mRNA 
0   NM_078653.1  CG18572-RA, transcript variant A (r), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 
0   NM_169966.1  CG31198-RA (CG31198), mRNA 
0   NM_136942.2  CG8545-RA (CG8545), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_078554.2  CG16944-RA, transcript variant A (sesB), mRNA 
0   NM_167246.1  CG16944-RC, transcript variant C (sesB), mRNA 
0   NM_167248.1  CG16944-RB, transcript variant B (sesB), mRNA 
0   NM_058065.2  CG5032-RA (aft), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_167247.1  CG16944-RD, transcript variant D (sesB), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_167251.1  CG1691-RF, transcript variant F (Imp), mRNA 
0   NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.