National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14006R-7 
 Symbol CG14006  Full Name CG14006 
 CG No CG14006  Old CG No CG14006 
 Synonyms CG14006 
 Accession No (Link to NCBI) NM_135109.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCAGCATCCTCGTTCGTGA 
 Primer Seq. 3'
aatctagaggtaccGAAAAGCAGCGAATCCGCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCAGCATC CTCGTTCGTG AACTGGGATA ATGTATTTTA CGAGCAGCAG GCGACGTATC 
0061 TGCGTCCTGG TGAGCCCCAC ATCCAGGAAG GACAGACGCT GCTTAACATG CTGTACGTGA 
0121 ACAACCAGGT CCAGGTCTAC TGCCAGCCGC CAACAGCGTT CTCCATGTGG AATGTCTTCC 
0181 AGAGCAACCG CCTGCGCCTG CAGATAGCCG CTGGCGAAGA TTACACTCAG TATAAAGGAG 
0241 CCACCGTGCG GGAAGTTCAT CATGCGCATA GCCAGCTGGA TGAGTGCCAC GAAGGAAAGC 
0301 CCTTGGGGCA TTCCGCAGNA GACGAGCCAC GGNATCGTTN CCGATGGCCA CGTATGAGCA 
0361 CTCCTGTTAC GGCATCTACA CATCCAAACC GTTCGTCCTC ACGCTTGAAG TGATCAGTTT 
0421 CGACCTTGAG CGGGTAAGCC AGTTCACCTT TGGCATCGTT TTATGGTTAA GCTGNCCGCN 
0481 NCtGGCGGAT TCGCTGCTTT TC 
 in silico PCR Fragment
0001 ATGCAGCATC CTCGTTCGTG AACTGGGATA ATGTATTTTA CGAGCAGCAG GCGACGTATC 
0061 TGCGTCCTGG TGAGCCCCAC ATCCAGGAAG GACAGACGCT GCTTAACATG CTGTACGTGA 
0121 ACAACCAGGT CCAGGTCTAC TGCCAGCCGC CAACAGCGTT CTCCATGTGG AATGTCTTCC 
0181 AGAGCAACCG CCTGCGCCTG CAGATAGCCG CTGGCGAAGA TTACACTCAG TATAAAGGAG 
0241 CCACCGTGCG GGAAGTTCAT CATGCGCATA GCCAGCTGGA TGAGTGCCAC GAAGGAAAGC 
0301 CCTTGGGGCA TTCCGCAGCA GACGAGCCAC GG-ATCGTT- CCGATGGCCA CGTATGAGCA 
0361 CTCCTGTTAC GGCATCTACA CATCCAAACC GTTCGTCCTC ACGCTTGAAG TGATCAGTTT 
0421 CGACCTTGAG CGGGTAAGCC AGTTCACCTT TGGCATCGTT TTATGGTTAA GCTGTCCGCT 
0481 CCTGGCGGAT TCGCTGCTTT TC 
 Assemble Data

14006R-7.IR_full       1   ATGCAGCATCCTCGTTCGTGAACTGGGATAATGTATTTTACGAGCAGCAGGCGACGTATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     1   ATGCAGCATCCTCGTTCGTGAACTGGGATAATGTATTTTACGAGCAGCAGGCGACGTATC 60


14006R-7.IR_full       61  TGCGTCCTGGTGAGCCCCACATCCAGGAAGGACAGACGCTGCTTAACATGCTGTACGTGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     61  TGCGTCCTGGTGAGCCCCACATCCAGGAAGGACAGACGCTGCTTAACATGCTGTACGTGA 120


14006R-7.IR_full       121 ACAACCAGGTCCAGGTCTACTGCCAGCCGCCAACAGCGTTCTCCATGTGGAATGTCTTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     121 ACAACCAGGTCCAGGTCTACTGCCAGCCGCCAACAGCGTTCTCCATGTGGAATGTCTTCC 180


14006R-7.IR_full       181 AGAGCAACCGCCTGCGCCTGCAGATAGCCGCTGGCGAAGATTACACTCAGTATAAAGGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     181 AGAGCAACCGCCTGCGCCTGCAGATAGCCGCTGGCGAAGATTACACTCAGTATAAAGGAG 240


14006R-7.IR_full       241 CCACCGTGCGGGAAGTTCATCATGCGCATAGCCAGCTGGATGAGTGCCACGAAGGAAAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     241 CCACCGTGCGGGAAGTTCATCATGCGCATAGCCAGCTGGATGAGTGCCACGAAGGAAAGC 300


14006R-7.IR_full       301 CCTTGGGGCATTCCGCAGNAGACGAGCCACGGNATCGTTNCCGATGGCCACGTATGAGCA 360
                           |||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||
14006R-7.in silico     301 CCTTGGGGCATTCCGCAGCAGACGAGCCACGG-ATCGTT-CCGATGGCCACGTATGAGCA 360


14006R-7.IR_full       361 CTCCTGTTACGGCATCTACACATCCAAACCGTTCGTCCTCACGCTTGAAGTGATCAGTTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14006R-7.in silico     361 CTCCTGTTACGGCATCTACACATCCAAACCGTTCGTCCTCACGCTTGAAGTGATCAGTTT 420


14006R-7.IR_full       421 CGACCTTGAGCGGGTAAGCCAGTTCACCTTTGGCATCGTTTTATGGTTAAGCTGNCCGCN 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| 
14006R-7.in silico     421 CGACCTTGAGCGGGTAAGCCAGTTCACCTTTGGCATCGTTTTATGGTTAAGCTGTCCGCT 480


14006R-7.IR_full        481 CTGGCGGATTCGCTGCTTTTC 501
                            |||||||||||||||||||||
14006R-7.in silico      481 CTGGCGGATTCGCTGCTTTTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135109.1  CG14006-RA (CG14006), mRNA 
0   NM_134521.2  CG17003-RA (CG17003), mRNA 
0   NM_080076.2  CG11770-RA (lin), mRNA 
0   NM_135311.2  CG14537-RA (CG14537), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_143628.2  CG1890-RA (CG1890), mRNA 
0   NM_168306.1  CG5651-RB, transcript variant B (CG5651), mRNA 
0   NM_140015.2  CG5651-RA, transcript variant A (CG5651), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_079323.2  CG10601-RA, transcript variant A (mirr), mRNA 
0   NM_168505.1  CG10601-RB, transcript variant B (mirr), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_142007.2  CG8483-RA (CG8483), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_057656.2  CG12345-RA, transcript variant A (Cha), mRNA 
0   NM_206517.1  CG12345-RB, transcript variant B (Cha), mRNA 
0   NM_136642.1  CG13955-RA (CG13955), mRNA 
0   NM_169587.1  CG7987-RB, transcript variant B (CG7987), mRNA 
0   NM_142118.1  CG7987-RA, transcript variant A (CG7987), mRNA 
0   NM_143426.2  CG14508-RA (CG14508), mRNA 
0   NM_135837.1  CG8997-RA (CG8997), mRNA 
0   NM_140812.2  CG3902-RA (CG3902), mRNA 
0   NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_141729.1  CG12817-RA, transcript variant A (CG12817), mRNA 
0   NM_001043236.1  CG12817-RB, transcript variant B (CG12817), mRNA 
0   NM_001043237.1  CG12817-RC, transcript variant C (CG12817), mRNA 
0   NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.