National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14006R-2 
 Symbol CG14006  Full Name CG14006 
 CG No CG14006  Old CG No CG14006 
 Synonyms CG14006 
 Accession No (Link to NCBI) NM_135109.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCAGCATCCTCGTTCGTGAACTGGGATAATGTATTTTACGAGCAGCAGGCGACGTATC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCGTCCTGGTGAGCCCCACATCCAGGAAGGACAGACGCTGCTTAACATGCTGTACGTGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAACCAGGTCCAGGTCTACTGCCAGCCGCCAACAGCGTTCTCCATGTGGAATGTCTTCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGAGCAACCGCCTGCGCCTGCAGATAGCCGCTGGCGAAGATTACACTCAGTATAAAGGAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCACCGTGCGGGAAGTTCATCATGCGCATAGCCAGCTGGATGAGTGCCACGAAGGAAAGC 300

                           |||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| silico     301 CCTTGGGGCATTCCGCAGCAGACGAGCCACGG-ATCGTT-CCGATGGCCACGTATGAGCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCCTGTTACGGCATCTACACATCCAAACCGTTCGTCCTCACGCTTGAAGTGATCAGTTT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     421 CGACCTTGAGCGGGTAAGCCAGTTCACCTTTGGCATCGTTTTATGGTTAAGCTGTCCGCT 480

14006R-2.IR_full        481 CTGGCGGATTCGCTGCTTTTC 501
                            ||||||||||||||||||||| silico      481 CTGGCGGATTCGCTGCTTTTC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135109.1  CG14006-RA (CG14006), mRNA 
0   NM_134521.2  CG17003-RA (CG17003), mRNA 
0   NM_080076.2  CG11770-RA (lin), mRNA 
0   NM_135311.2  CG14537-RA (CG14537), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_143628.2  CG1890-RA (CG1890), mRNA 
0   NM_168306.1  CG5651-RB, transcript variant B (CG5651), mRNA 
0   NM_140015.2  CG5651-RA, transcript variant A (CG5651), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_079323.2  CG10601-RA, transcript variant A (mirr), mRNA 
0   NM_168505.1  CG10601-RB, transcript variant B (mirr), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_142007.2  CG8483-RA (CG8483), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_057656.2  CG12345-RA, transcript variant A (Cha), mRNA 
0   NM_206517.1  CG12345-RB, transcript variant B (Cha), mRNA 
0   NM_136642.1  CG13955-RA (CG13955), mRNA 
0   NM_169587.1  CG7987-RB, transcript variant B (CG7987), mRNA 
0   NM_142118.1  CG7987-RA, transcript variant A (CG7987), mRNA 
0   NM_143426.2  CG14508-RA (CG14508), mRNA 
0   NM_135837.1  CG8997-RA (CG8997), mRNA 
0   NM_140812.2  CG3902-RA (CG3902), mRNA 
0   NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_141729.1  CG12817-RA, transcript variant A (CG12817), mRNA 
0   NM_001043236.1  CG12817-RB, transcript variant B (CG12817), mRNA 
0   NM_001043237.1  CG12817-RC, transcript variant C (CG12817), mRNA 
0   NM_057431.2  CG7171-RA (Uro), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.