National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14005R-2 
 Symbol CG14005  Full Name CG14005 
 CG No CG14005  Old CG No CG14005 
 Synonyms CG14005 
 Accession No (Link to NCBI) NM_135115.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCTGCAGCAGAACGGAGTTCGGCTCAATAAGCAGGAGGCTCGCCGGCGCATCAACAGCTA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCAACAAGTATTTGAACGATCGCAATCGCGTGGGGGGCAATGCGAACTTCGCGAAGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTGGCGTCTCTACGCGCTGATCGATTGCCTCTTCTGTCCTGCCTGGCCGTCGTCCGCCCT 180

                           |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| silico     181 CTTCCATTTCCGCAATGTGCTGGAGACGATC--CGTGCGACAGCACGTGTGGATTTGCCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCCTGCCGCCACTGCTATACACTTCGCCCGCCCAGCTAAAATTTGAGCGCGACTCAGAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGATGCACCTTCCTCGATGCCCAGCCCCTAGTTCCCGCAGTAGTGAAGACAGAGCCTCTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCAGACGAACACCACCAGCTGGTGAATATTGAATACAAGCCCACAGTGACGCAGCTGGAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     421 AACGCGGCTAGCCACTACCTGGAGAGAGCTACTGCCGAAAGTGTCATTCAGCGGTCGCCT 480

14005R-2.IR_full       481 CTCACGCCTGCCAACCACATCC 502
                           |||||||||||||||||||||| silico     481 CTCACGCCTGCCAACCACATCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135115.2  CG14005-RA (CG14005), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   NM_142619.1  CG4362-RA (CG4362), mRNA 
0   NM_134938.2  CG3238-RA (CG3238), mRNA 
0   13  NM_001032067.1  CG6713-RH, transcript variant H (Nos), mRNA 
0   13  NM_001032072.1  CG6713-RC, transcript variant C (Nos), mRNA 
0   13  NM_001032075.1  CG6713-RI, transcript variant I (Nos), mRNA 
0   13  NM_001032073.1  CG6713-RB, transcript variant B (Nos), mRNA 
0   13  NM_001032074.1  CG6713-RJ, transcript variant J (Nos), mRNA 
0   13  NM_001032069.1  CG6713-RF, transcript variant F (Nos), mRNA 
0   13  NM_001032068.1  CG6713-RG, transcript variant G (Nos), mRNA 
0   13  NM_078817.3  CG6713-RA, transcript variant A (Nos), mRNA 
0   13  NM_001032071.1  CG6713-RD, transcript variant D (Nos), mRNA 
0   NM_079627.2  CG3351-RA (mRpL11), mRNA 
0   NM_134989.2  CG3351-RA (mRpL11), mRNA, ubiquitously expressed CG15437-RA (morgue), mRNA 
0   NM_141819.1  CG5281-RA (CG5281), mRNA 
0   NM_079300.2  CG11720-RA (Sgs3), mRNA 
0   NM_140917.1  CG14186-RA (CG14186), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_166794.1  CG2999-RB, transcript variant B (unc-13), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_079530.2  CG17945-RA (Mst84Dc), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_135451.1  CG3818-RA (CG3818), mRNA 
0   NM_144349.2  CG12132-RA (c11.1), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_079453.2  CG6975-RA (gig), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.