National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14005R-1 
 Symbol CG14005  Full Name CG14005 
 CG No CG14005  Old CG No CG14005 
 Synonyms CG14005 
 Accession No (Link to NCBI) NM_135115.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCAGCAGAACGGAGTTCG 
 Primer Seq. 3'
aatctagaggtaccGGATGTGGTTGGCAGGCGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCAGCAG AACGGAGTTC GGCTCAATAA GCAGGAGGCT CGCCGGCGCA TCAACAGCTA 
0061 CCGCAACAAG TATTTGAACG ATCGCAATCG CGTGGGGGGC AATGCGAACT TCGCGAAGGA 
0121 TTGGCGTCTC TACGCGCTGA TCGATTGCCT CTTCTGTCCT GCCTGGCCGT CGTCCGCCCT 
0181 CTTCCATTTC CGCAATGTGC TGGAGACGAT CCGCGTGCGA CAGCACGTGT GGATTTGCCC 
0241 GCCCTGCCGC CACTGCTATA CACTTCGCCC GCCCAGCTAA AATTTGAGCG CGACTCAGAG 
0301 GGATGCACCT TCCTCGATGC CCAGCCCCTA GTTCCCGCAG TAGTGAAGAC AGAGCCTCTG 
0361 CCAGACGAAC ACCACCAGCT GGTGAATATT GAATACAAGC CCACAGTGAC GCAGCTGGAA 
0421 AACGCGGCTA GCCACTACCT GGAGAGAGCT ACTGCCGAAA GTGTCATTCA NCGGTCGCCT 
0481 CTCACGCCTg CCAACCACAT CC 
 in silico PCR Fragment
0001 CCTGCAGCAG AACGGAGTTC GGCTCAATAA GCAGGAGGCT CGCCGGCGCA TCAACAGCTA 
0061 CCGCAACAAG TATTTGAACG ATCGCAATCG CGTGGGGGGC AATGCGAACT TCGCGAAGGA 
0121 TTGGCGTCTC TACGCGCTGA TCGATTGCCT CTTCTGTCCT GCCTGGCCGT CGTCCGCCCT 
0181 CTTCCATTTC CGCAATGTGC TGGAGACGAT C--CGTGCGA CAGCACGTGT GGATTTGCCC 
0241 GCCCTGCCGC CACTGCTATA CACTTCGCCC GCCCAGCTAA AATTTGAGCG CGACTCAGAG 
0301 GGATGCACCT TCCTCGATGC CCAGCCCCTA GTTCCCGCAG TAGTGAAGAC AGAGCCTCTG 
0361 CCAGACGAAC ACCACCAGCT GGTGAATATT GAATACAAGC CCACAGTGAC GCAGCTGGAA 
0421 AACGCGGCTA GCCACTACCT GGAGAGAGCT ACTGCCGAAA GTGTCATTCA GCGGTCGCCT 
0481 CTCACGCCTG CCAACCACAT CC 
 Assemble Data

14005R-1.IR_full       1   CCTGCAGCAGAACGGAGTTCGGCTCAATAAGCAGGAGGCTCGCCGGCGCATCAACAGCTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     1   CCTGCAGCAGAACGGAGTTCGGCTCAATAAGCAGGAGGCTCGCCGGCGCATCAACAGCTA 60


14005R-1.IR_full       61  CCGCAACAAGTATTTGAACGATCGCAATCGCGTGGGGGGCAATGCGAACTTCGCGAAGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     61  CCGCAACAAGTATTTGAACGATCGCAATCGCGTGGGGGGCAATGCGAACTTCGCGAAGGA 120


14005R-1.IR_full       121 TTGGCGTCTCTACGCGCTGATCGATTGCCTCTTCTGTCCTGCCTGGCCGTCGTCCGCCCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     121 TTGGCGTCTCTACGCGCTGATCGATTGCCTCTTCTGTCCTGCCTGGCCGTCGTCCGCCCT 180


14005R-1.IR_full       181 CTTCCATTTCCGCAATGTGCTGGAGACGATCCGCGTGCGACAGCACGTGTGGATTTGCCC 240
                           |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
14005R-1.in silico     181 CTTCCATTTCCGCAATGTGCTGGAGACGATC--CGTGCGACAGCACGTGTGGATTTGCCC 240


14005R-1.IR_full       241 GCCCTGCCGCCACTGCTATACACTTCGCCCGCCCAGCTAAAATTTGAGCGCGACTCAGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     241 GCCCTGCCGCCACTGCTATACACTTCGCCCGCCCAGCTAAAATTTGAGCGCGACTCAGAG 300


14005R-1.IR_full       301 GGATGCACCTTCCTCGATGCCCAGCCCCTAGTTCCCGCAGTAGTGAAGACAGAGCCTCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     301 GGATGCACCTTCCTCGATGCCCAGCCCCTAGTTCCCGCAGTAGTGAAGACAGAGCCTCTG 360


14005R-1.IR_full       361 CCAGACGAACACCACCAGCTGGTGAATATTGAATACAAGCCCACAGTGACGCAGCTGGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14005R-1.in silico     361 CCAGACGAACACCACCAGCTGGTGAATATTGAATACAAGCCCACAGTGACGCAGCTGGAA 420


14005R-1.IR_full       421 AACGCGGCTAGCCACTACCTGGAGAGAGCTACTGCCGAAAGTGTCATTCANCGGTCGCCT 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
14005R-1.in silico     421 AACGCGGCTAGCCACTACCTGGAGAGAGCTACTGCCGAAAGTGTCATTCAGCGGTCGCCT 480


14005R-1.IR_full       481 CTCACGCCTGCCAACCACATCC 502
                           ||||||||||||||||||||||
14005R-1.in silico     481 CTCACGCCTGCCAACCACATCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135115.2  CG14005-RA (CG14005), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   NM_142619.1  CG4362-RA (CG4362), mRNA 
0   NM_134938.2  CG3238-RA (CG3238), mRNA 
0   13  NM_001032067.1  CG6713-RH, transcript variant H (Nos), mRNA 
0   13  NM_001032072.1  CG6713-RC, transcript variant C (Nos), mRNA 
0   13  NM_001032075.1  CG6713-RI, transcript variant I (Nos), mRNA 
0   13  NM_001032073.1  CG6713-RB, transcript variant B (Nos), mRNA 
0   13  NM_001032074.1  CG6713-RJ, transcript variant J (Nos), mRNA 
0   13  NM_001032069.1  CG6713-RF, transcript variant F (Nos), mRNA 
0   13  NM_001032068.1  CG6713-RG, transcript variant G (Nos), mRNA 
0   13  NM_078817.3  CG6713-RA, transcript variant A (Nos), mRNA 
0   13  NM_001032071.1  CG6713-RD, transcript variant D (Nos), mRNA 
0   NM_079627.2  CG3351-RA (mRpL11), mRNA 
0   NM_134989.2  CG3351-RA (mRpL11), mRNA, ubiquitously expressed CG15437-RA (morgue), mRNA 
0   NM_141819.1  CG5281-RA (CG5281), mRNA 
0   NM_079300.2  CG11720-RA (Sgs3), mRNA 
0   NM_140917.1  CG14186-RA (CG14186), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_166794.1  CG2999-RB, transcript variant B (unc-13), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_079530.2  CG17945-RA (Mst84Dc), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_135451.1  CG3818-RA (CG3818), mRNA 
0   NM_144349.2  CG12132-RA (c11.1), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_079453.2  CG6975-RA (gig), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.