National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14001R-1 
 Symbol bchs  Full Name blue cheese 
 CG No CG14001  Old CG No CG14001 
 Synonyms CG9011, CG14001, DBEACH1, EP2299, bchd, BcDNA:SD12984, bchs 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAACCTCGACGGCGAACAACA 
 Primer Seq. 3'
aatctagaggtaccGATACGTCTCCATTGGCCAAC 
 Predicted Fragment Size
463 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

14001R-1.IR full       1   GAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     1   GAACCTCGACGGCGAACAACAGTTCACCAGGGAGCAGCAGAACGGATGCTGGTGCACCGA 60


14001R-1.IR full       61  CCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     61  CCGCTGCAAATGGACGGAATGCGGAGGAGGCGCTGATGGACGCCCGCGTCCAAGTGAGCC 120


14001R-1.IR full       121 TCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     121 TCACCACGCTAAAGAAGCTATTCAACGAATACACTCATCCGCGGGAGCCGCTGAGCGAAC 180


14001R-1.IR full       181 AGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTCTTCAGCAGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     181 AGGAGCGCGATGACAAGCTCTACGAGATGCTGCCCCTCTTCTGCAAAGTCTTCAGCAGCT 240


14001R-1.IR full       241 GTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     241 GTCCGTCAAACGACATGAGCGAAAAGTTCTGGGACGTGGTCGCCTTCTGCCAGCAAGTGT 300


14001R-1.IR full       301 CCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     301 CCCGTCTCATGGTCAGCGAAATCCGCAAGCGCGCCTCCAACCAGAGCACAGAGGCGGCAT 360


14001R-1.IR full       361 CCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     361 CCATTGCCATAGTCAAGTTTCTCGAGGTGGAAACCACCGAGGAAACCAGCAGCGGATGGA 420


14001R-1.IR full       421 TGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATC 463
                           |||||||||||||||||||||||||||||||||||||||||||
14001R-1.in silico     421 TGCTTTTGGCTACCCTCAATTTGTTGGCCAATGGAGACGTATC 463

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.