National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13999R-2 
 Symbol CG13999  Full Name CG13999 
 CG No CG13999  Old CG No CG13999 
 Synonyms CG13999 
 Accession No (Link to NCBI) NM_135128.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTAACACTGCGACGCTACT 
 Primer Seq. 3'
aatctagaggtaccCTTATCGCCCAGCTGATCTGC 
 Predicted Fragment Size
491 
 IR fragment full Seq
0001 AGCTAACACT GCGACgNTAC TCCTGGGTGC TCCTGTTCCA GTTCGCCCTT TTGGGAGTGG 
0061 ACCTCTTTTG CAACGCCTTT GGTCCTTCGC TGGCCAGAAA CCGATTGCAG ACAGCCATAA 
0121 TTCTCTTTGT CACTCAGGAT GCCCTGATTA TCGCGGAGTA CCTGCTGTTC ACCCTCGCCC 
0181 TGCACTCGAC GTGTGTGTAC CAGGTCGGCG CCTCGCACAT AATNCTGCGG AATTGCAAGC 
0241 TCTTCATGGC CAGCATTACC ATCTACTTCC TTCTGTCCGC CTCCCAGCAC TTTTGGATCA 
0301 TCTACCAATA CCGTCAGCCG CCAGAAGAGG ACGGTCATCA TTGGCCACTG GGTCTGATTG 
0361 CCCTATCAGT GGCACAGCGC ATCATGTCGG TTTTCTATTA CTACAGCTCC AAGTCGACGG 
0421 CTCTGACCAT GGNCAGATCC TCGCTTCAAG GAGGAGCATC TTNGACTGGA TCGCAGATCA 
0481 GCTGGGCGAT AAG 
 in silico PCR Fragment
0001 AGCTAACACT GCGACGCTAC TCCTGGGTGC TCCTGTTCCA GTTCGCCCTT TTGGGAGTGG 
0061 ACCTCTTTTG CAACGCCTTT GGTCCTTCGC TGGCCAGAAA CCGATTGCAG ACAGCCATAA 
0121 TTCTCTTTGT CACTCAGGAT GCCCTGATTA TCGCGGAGTA CCTGCTGTTC ACCCTCGCCC 
0181 TGCACTCGAC GTGTGTGTAC CAGGTCGGCG CCTCGCACAT AATCCTGCGG AATTGCAAGC 
0241 TCTTCATGGC CAGCATTACC ATCTACTTCC TTCTGTCCGC CTCCCAGCAC TTTTGGATCA 
0301 TCTACCAATA CCGTCAGCCG CCAGAAGAGG ACGGTCATCA TTGGCCACTG GGTCTGATTG 
0361 CCCTATCAGT GGCACAGCGC ATCATGTCGG TTTTCTATTA CTACAGCTCC AAGTCGACGG 
0421 CTCTGACCAT GG-CAGATCC TCGCTTCAAG GAGGAGCATC TT-GACTGGA TCGCAGATCA 
0481 GCTGGGCGAT AAG 
 Assemble Data

13999R-2.IR_full       1   AGCTAACACTGCGACGNTACTCCTGGGTGCTCCTGTTCCAGTTCGCCCTTTTGGGAGTGG 60
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     1   AGCTAACACTGCGACGCTACTCCTGGGTGCTCCTGTTCCAGTTCGCCCTTTTGGGAGTGG 60


13999R-2.IR_full       61  ACCTCTTTTGCAACGCCTTTGGTCCTTCGCTGGCCAGAAACCGATTGCAGACAGCCATAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     61  ACCTCTTTTGCAACGCCTTTGGTCCTTCGCTGGCCAGAAACCGATTGCAGACAGCCATAA 120


13999R-2.IR_full       121 TTCTCTTTGTCACTCAGGATGCCCTGATTATCGCGGAGTACCTGCTGTTCACCCTCGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     121 TTCTCTTTGTCACTCAGGATGCCCTGATTATCGCGGAGTACCTGCTGTTCACCCTCGCCC 180


13999R-2.IR_full       181 TGCACTCGACGTGTGTGTACCAGGTCGGCGCCTCGCACATAATNCTGCGGAATTGCAAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13999R-2.in silico     181 TGCACTCGACGTGTGTGTACCAGGTCGGCGCCTCGCACATAATCCTGCGGAATTGCAAGC 240


13999R-2.IR_full       241 TCTTCATGGCCAGCATTACCATCTACTTCCTTCTGTCCGCCTCCCAGCACTTTTGGATCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     241 TCTTCATGGCCAGCATTACCATCTACTTCCTTCTGTCCGCCTCCCAGCACTTTTGGATCA 300


13999R-2.IR_full       301 TCTACCAATACCGTCAGCCGCCAGAAGAGGACGGTCATCATTGGCCACTGGGTCTGATTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     301 TCTACCAATACCGTCAGCCGCCAGAAGAGGACGGTCATCATTGGCCACTGGGTCTGATTG 360


13999R-2.IR_full       361 CCCTATCAGTGGCACAGCGCATCATGTCGGTTTTCTATTACTACAGCTCCAAGTCGACGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13999R-2.in silico     361 CCCTATCAGTGGCACAGCGCATCATGTCGGTTTTCTATTACTACAGCTCCAAGTCGACGG 420


13999R-2.IR_full       421 CTCTGACCATGGNCAGATCCTCGCTTCAAGGAGGAGCATCTTNGACTGGATCGCAGATCA 480
                           |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||
13999R-2.in silico     421 CTCTGACCATGG-CAGATCCTCGCTTCAAGGAGGAGCATCTT-GACTGGATCGCAGATCA 480


13999R-2.IR_full       481 GCTGGGCGATAAG 493
                           |||||||||||||
13999R-2.in silico     481 GCTGGGCGATAAG 493

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   473  NM_135128.1  CG13999-RA (CG13999), mRNA 
0.21   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0.21   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_130730.1  CG2941-RA (CG2941), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_131964.1  CG15470-RA (CG15470), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_140627.2  CG4784-RA (CG4784), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_057802.4  CG12390-RA (dare), mRNA 
0   NM_167230.1  CG32683-RA (CG32683), mRNA 
0   NM_134761.2  CG10869-RA (CG10869), mRNA 
0   NM_057520.3  CG3497-RA (Su(H)), mRNA 
0   NM_142990.2  CG6432-RA (CG6432), mRNA 
0   NM_135575.1  CG18301-RA (CG18301), mRNA 
0   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0   NM_170324.1  CG31064-RB, transcript variant B (CG31064), mRNA 
0   NM_001015220.1  CG41141-PA (CG41141), mRNA 
0   NM_132116.1  CG14441-RA (CG14441), mRNA 
0   NM_001038946.1  CG33969-RB, transcript variant B (CG33969), mRNA 
0   NM_080312.2  CG7803-RA, transcript variant A (z), mRNA 
0   NM_001038738.1  CG7803-RB, transcript variant B (z), mRNA 
0   NM_138243.2  CG9128-RA (Sac1), mRNA 
0   NM_168852.2  CG5725-RD, transcript variant D (fbl), mRNA 
0   NM_168851.2  CG5725-RC, transcript variant C (fbl), mRNA 
0   NM_138997.2  CG5725-RA, transcript variant A (fbl), mRNA 
0   NM_080131.4  CG5725-RE, transcript variant E (fbl), mRNA 
0   NM_133434.3  CG5725-RB, transcript variant B (fbl), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.