National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13995R-3 
 Symbol CG13995  Full Name CG13995 
 CG No CG13995  Old CG No CG13995 
 Synonyms anon-WO0170980.170, anon-WO0170980.169, CG13995 
 Accession No (Link to NCBI) NM_135142.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J Neurogenet (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGGACAATCTGCAGCAGTGG 
 Primer Seq. 3'
aatctagaggtaccCGGTCAAGGGAGAGCATGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGGACAATC TGCAGCAGTG GTGGGAGAAC TCGTATCGGC GCCAACATCC AGAGCCCACC 
0061 GATGACCTCG GCCTGGACTC CGCGGAGCTG NCATCTCGCC CTCCAGGAGC CCAACCAGCT 
0121 GCCCGCGGAC TACGACTATG GCAACTTTAG TCTAGGCAAT CCGTATGACG TGGACTCAGA 
0181 GCACTCCATT TCCCCGCTGA CGCTGCTCCT GCTCGCTGTT AGCTATGGCC TGGTGGTTTT 
0241 CGGCGGCGTC GTGGGCAACT CCACGCTCGT TCTGACCCTC TGCTCCGCCT CTTCGGTGCG 
0301 TTTGCGTAAC CCGCTGCTGC TGGCCGTCTG GCATTGCCGA TCTCCTGGTC ACCgGNATNT 
0361 NCCGNNCCGG TCACGCTCCT CAATCTCGCG ATGAACCGGA GGNCGNGATC GCTGCCCCTT 
0421 GTGCTGTGCA AGGTCATACA cTACGTACAG GTGCATGcCC GTTTCGGCCA GCACTATTTC 
0481 GTTTTTCATG CTCTNCCTTG ACCG 
 in silico PCR Fragment
0001 AGGGACAATC TGCAGCAGTG GTGGGAGAAC TCGTATCGGC GCCAACATCC AGAGCCCACC 
0061 GATGACCTCG GCCTGGACTC CGCGGAGCTG -CATCTCGCC CTCCAGGAGC CCAACCAGCT 
0121 GCCCGCGGAC TACGACTATG GCAACTTTAG TCTAGGCAAT CCGTATGACG TGGACTCAGA 
0181 GCACTCCATT TCCCCGCTGA CGCTGCTCCT GCTCGCTGTT AGCTATGGCC TGGTGGTTTT 
0241 CGGCGGCGTC GTGGGCAACT CCACGCTCGT TCTGACCCTC TGCTCCGCCT CTTCGGTGCG 
0301 TTTGCGTAAC CCGCTGCTGC TGGCCGTCT- GCATTGCCGA TCTCCTGGTC ACCGGCATCT 
0361 -CCGCTCCGG TCACGCTCCT CAATCTCGCG ATGAACCGGA GGACGCGATC GCTGCCCCTT 
0421 GTGCTGTGCA AGGTCATACA CTACGTACAG GT-CATGCCC GTTTCGGCCA GCACTATTTC 
0481 GTTTTTCATG CTCTCCCTTG ACCG 
 Assemble Data

13995R-3.IR_full       1   AGGGACAATCTGCAGCAGTGGTGGGAGAACTCGTATCGGCGCCAACATCCAGAGCCCACC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13995R-3.in silico     1   AGGGACAATCTGCAGCAGTGGTGGGAGAACTCGTATCGGCGCCAACATCCAGAGCCCACC 60


13995R-3.IR_full       61  GATGACCTCGGCCTGGACTCCGCGGAGCTGNCATCTCGCCCTCCAGGAGCCCAACCAGCT 120
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
13995R-3.in silico     61  GATGACCTCGGCCTGGACTCCGCGGAGCTG-CATCTCGCCCTCCAGGAGCCCAACCAGCT 120


13995R-3.IR_full       121 GCCCGCGGACTACGACTATGGCAACTTTAGTCTAGGCAATCCGTATGACGTGGACTCAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13995R-3.in silico     121 GCCCGCGGACTACGACTATGGCAACTTTAGTCTAGGCAATCCGTATGACGTGGACTCAGA 180


13995R-3.IR_full       181 GCACTCCATTTCCCCGCTGACGCTGCTCCTGCTCGCTGTTAGCTATGGCCTGGTGGTTTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13995R-3.in silico     181 GCACTCCATTTCCCCGCTGACGCTGCTCCTGCTCGCTGTTAGCTATGGCCTGGTGGTTTT 240


13995R-3.IR_full       241 CGGCGGCGTCGTGGGCAACTCCACGCTCGTTCTGACCCTCTGCTCCGCCTCTTCGGTGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13995R-3.in silico     241 CGGCGGCGTCGTGGGCAACTCCACGCTCGTTCTGACCCTCTGCTCCGCCTCTTCGGTGCG 300


13995R-3.IR_full       301 TTTGCGTAACCCGCTGCTGCTGGCCGTCTGGCATTGCCGATCTCCTGGTCACCGGNATNT 360
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
13995R-3.in silico     301 TTTGCGTAACCCGCTGCTGCTGGCCGTCT-GCATTGCCGATCTCCTGGTCACCGGCATCT 360


13995R-3.IR_full        361 CCGNNCCGGTCACGCTCCTCAATCTCGCGATGAACCGGAGGNCGNGATCGCTGCCCCTT 419
                            |||  |||||||||||||||||||||||||||||||||||| || ||||||||||||||
13995R-3.in silico      361 CCGCTCCGGTCACGCTCCTCAATCTCGCGATGAACCGGAGGACGCGATCGCTGCCCCTT 419


13995R-3.IR_full       421 GTGCTGTGCAAGGTCATACACTACGTACAGGTGCATGCCCGTTTCGGCCAGCACTATTTC 479
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
13995R-3.in silico     421 GTGCTGTGCAAGGTCATACACTACGTACAGGT-CATGCCCGTTTCGGCCAGCACTATTTC 479


13995R-3.IR_full       481 GTTTTTCATGCTCTNCCTTGACCG 503
                           |||||||||||||| |||||||||
13995R-3.in silico     481 GTTTTTCATGCTCTCCCTTGACCG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135142.1  CG13995-RA (CG13995), mRNA 
0   NM_001038728.1  CG4293-RC, transcript variant C (CG4293), mRNA 
0   NM_130491.3  CG4293-RA, transcript variant A (CG4293), mRNA 
0   NM_166847.2  CG4293-RB, transcript variant B (CG4293), mRNA 
0   NM_001038727.1  CG4293-RD, transcript variant D (CG4293), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001031909.1  CG33517-RE, transcript variant E (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_141919.2  CG10038-RA, transcript variant A (CG10038), mRNA 
0   NM_169460.1  CG10038-RB, transcript variant B (CG10038), mRNA 
0   NM_001015269.1  CG40450-PA.3 (CG40450), mRNA 
0   NM_001015268.1  CG40450-PB.3 (CG40450), mRNA 
0   NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   12  NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_140771.2  CG5147-RA (CG5147), mRNA 
0   NM_143596.2  CG12054-RA (CG12054), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_135646.2  CG6230-RA (CG6230), mRNA 
0   NM_135688.2  CG5202-RB, transcript variant B (escl), mRNA 
0   NM_164979.1  CG5202-RA, transcript variant A (escl), mRNA 
0   NM_140990.1  CG13253-RA (CG13253), mRNA 
0   NM_166484.1  CG17952-RC, transcript variant C (LBR), mRNA 
0   NM_137764.2  CG17952-RA, transcript variant A (LBR), mRNA 
0   NM_166485.1  CG17952-RB, transcript variant B (LBR), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.