National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13995R-1 
 Symbol CG13995  Full Name CG13995 
 CG No CG13995  Old CG No CG13995 
 Synonyms anon-WO0170980.170, anon-WO0170980.169, CG13995 
 Accession No (Link to NCBI) NM_135142.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGGGACAATCTGCAGCAGTGGTGGGAGAACTCGTATCGGCGCCAACATCCAGAGCCCACC 60

                           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     61  GATGACCTCGGCCTGGACTCCGCGGAGCTG-CATCTCGCCCTCCAGGAGCCCAACCAGCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCCGCGGACTACGACTATGGCAACTTTAGTCTAGGCAATCCGTATGACGTGGACTCAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCACTCCATTTCCCCGCTGACGCTGCTCCTGCTCGCTGTTAGCTATGGCCTGGTGGTTTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGGCGGCGTCGTGGGCAACTCCACGCTCGTTCTGACCCTCTGCTCCGCCTCTTCGGTGCG 300

                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || | silico     301 TTTGCGTAACCCGCTGCTGCTGGCCGTCT-GCATTGCCGATCTCCTGGTCACCGGCATCT 360

                            |||  |||||||||||||||||||||||||||||||||||| || |||||||||||||| silico      361 CCGCTCCGGTCACGCTCCTCAATCTCGCGATGAACCGGAGGACGCGATCGCTGCCCCTT 419

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     421 GTGCTGTGCAAGGTCATACACTACGTACAGGT-CATGCCCGTTTCGGCCAGCACTATTTC 479

13995R-1.IR_full       481 GTTTTTCATGCTCTNCCTTGACCG 503
                           |||||||||||||| ||||||||| silico     481 GTTTTTCATGCTCTCCCTTGACCG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135142.1  CG13995-RA (CG13995), mRNA 
0   NM_001038728.1  CG4293-RC, transcript variant C (CG4293), mRNA 
0   NM_130491.3  CG4293-RA, transcript variant A (CG4293), mRNA 
0   NM_166847.2  CG4293-RB, transcript variant B (CG4293), mRNA 
0   NM_001038727.1  CG4293-RD, transcript variant D (CG4293), mRNA 
0   NM_137918.2  CG12192-RA (Klp59D), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001031909.1  CG33517-RE, transcript variant E (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_141919.2  CG10038-RA, transcript variant A (CG10038), mRNA 
0   NM_169460.1  CG10038-RB, transcript variant B (CG10038), mRNA 
0   NM_001015269.1  CG40450-PA.3 (CG40450), mRNA 
0   NM_001015268.1  CG40450-PB.3 (CG40450), mRNA 
0   NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   12  NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_140771.2  CG5147-RA (CG5147), mRNA 
0   NM_143596.2  CG12054-RA (CG12054), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_135646.2  CG6230-RA (CG6230), mRNA 
0   NM_135688.2  CG5202-RB, transcript variant B (escl), mRNA 
0   NM_164979.1  CG5202-RA, transcript variant A (escl), mRNA 
0   NM_140990.1  CG13253-RA (CG13253), mRNA 
0   NM_166484.1  CG17952-RC, transcript variant C (LBR), mRNA 
0   NM_137764.2  CG17952-RA, transcript variant A (LBR), mRNA 
0   NM_166485.1  CG17952-RB, transcript variant B (LBR), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.