National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13994R-3 
 Symbol CG13994  Full Name CG13994 
 CG No CG13994  Old CG No CG13994 
 Synonyms BcDNA:AT31406, CG13994 
 Accession No (Link to NCBI) NM_135144.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCCCATAAGCAGAGCACGAACAATGAGACATCCAATGGCTCGACAACTGAAATAATTG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGAAACCGATGCCCGTGCTCAATTGGAATCGGGCCGGACCACACCCACTCTTCTGTTGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCTCGAACATCCGCGGAATGAACGCCGGGTGGCCTTTCACGCTGGGATCATCGACAACG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCATTTGAATCGCAAGAAGTCCAAATGCTGCTGCATTTACAAAAAACCTCTCGCGTTCG 240

                           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCGAGAGCTCC-TCTGAGGATGACGAAGACTGTGAGCACTGCTTTGGACATCCGGAAAAG 300

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     301 CGTCAGAGAAACGCAAAACACAATCACAATCACGGGGACAAACCATGCACGGAGGCGTCG 360

                           |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     361 CATCCGGAAGGACC-TTCGACATCAACGCAGGCCGCGCACATCAGTCAACCGCCAGCCGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCTGTTGAATCGAAGACCGATCCAAAACCACCTACCCCAGGTGTTGACTTTGAGCAGAC 480

13994R-3.IR_full       481 GGGCAGCTCG 490
                           |||||||||| silico     481 GGGCAGCTCG 490

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   470  NM_135144.2  CG13994-RA (CG13994), mRNA 
0   NM_139473.2  CG16985-RA (CG16985), mRNA 
0   NM_168395.1  CG32054-RA (CG32054), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_079065.3  CG15113-RA (5-HT1B), mRNA 
0   NM_136673.2  CG1698-RA (CG1698), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   NM_079683.2  CG4550-RA (ninaE), mRNA 
0   NM_142229.2  CG4525-RA (CG4525), mRNA 
0   14  NM_167716.2  CG11233-RA (l(1)19Ec), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_137833.1  CG4610-RA (CG4610), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_079137.2  CG3533-RA (uzip), mRNA 
0   NM_135933.2  CG4891-RA (CG4891), mRNA 
0   NM_137795.1  CG6613-RA (CG6613), mRNA 
0   NM_001014658.1  CG10693-RJ, transcript variant J (slo), mRNA 
0   NM_001014659.1  CG10693-RI, transcript variant I (slo), mRNA 
0   NM_137943.2  CG3493-RA (CG3493), mRNA 
0   NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
0   NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
0   NM_141679.1  CG12948-RA (CG12948), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_132981.1  CG8675-RA (CG8675), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.