National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13994R-2 
 Symbol CG13994  Full Name CG13994 
 CG No CG13994  Old CG No CG13994 
 Synonyms BcDNA:AT31406, CG13994 
 Accession No (Link to NCBI) NM_135144.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCCCATAAGCAGAGCACGA 
 Primer Seq. 3'
aatctagaggtaccCGAGCTGCCCGTCTGCTCAAA 
 Predicted Fragment Size
488 
 IR fragment full Seq
0001 TGGCCCATAA GCAGAGcACG AACAATGAGA CATCCAATGG CTCGACAACT GAAATAATTG 
0061 ACGAAACCGA TGCCCGTGCT CAATTGGAAT CGGGCCGGAC CACACCCACT CTTCTGTTGC 
0121 GCCTCGAACA TCCGCGGAAT GAACGCCGGG TGGCCTTTCA CGCTGGGATC ATCGACAACG 
0181 AGCATTTGAA TCGCAAGAAG TCCAAATGCT GCTGCATTTA CAAAAAACCT CTCGCGTTCG 
0241 GCGAGAGCTC CTTCTGAGGA TGACGAAGAC TGTGAGCACT GCTTTGGACA TCCGGAAAAG 
0301 CGTCAGAGAA ACGCAAAACA CAATCACAAT CACGGGGACA AACCATGCAC GGAGGNGTCG 
0361 CATCCGGAAG GACCTTTCGA CATCAACGCA GGCCGCGCAC ATCAGTCAAC CGCCAGCCGA 
0421 GCCTGTTGAA TCGAAGACCG ATCCAAAACC ACCTACCCCA GGTGTTGACT TTGAGCAGAC 
0481 GGGCAGCTCG  
 in silico PCR Fragment
0001 TGGCCCATAA GCAGAGCACG AACAATGAGA CATCCAATGG CTCGACAACT GAAATAATTG 
0061 ACGAAACCGA TGCCCGTGCT CAATTGGAAT CGGGCCGGAC CACACCCACT CTTCTGTTGC 
0121 GCCTCGAACA TCCGCGGAAT GAACGCCGGG TGGCCTTTCA CGCTGGGATC ATCGACAACG 
0181 AGCATTTGAA TCGCAAGAAG TCCAAATGCT GCTGCATTTA CAAAAAACCT CTCGCGTTCG 
0241 GCGAGAGCTC C-TCTGAGGA TGACGAAGAC TGTGAGCACT GCTTTGGACA TCCGGAAAAG 
0301 CGTCAGAGAA ACGCAAAACA CAATCACAAT CACGGGGACA AACCATGCAC GGAGGCGTCG 
0361 CATCCGGAAG GACC-TTCGA CATCAACGCA GGCCGCGCAC ATCAGTCAAC CGCCAGCCGA 
0421 GCCTGTTGAA TCGAAGACCG ATCCAAAACC ACCTACCCCA GGTGTTGACT TTGAGCAGAC 
0481 GGGCAGCTCG  
 Assemble Data

13994R-2.IR_full       1   TGGCCCATAAGCAGAGCACGAACAATGAGACATCCAATGGCTCGACAACTGAAATAATTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     1   TGGCCCATAAGCAGAGCACGAACAATGAGACATCCAATGGCTCGACAACTGAAATAATTG 60


13994R-2.IR_full       61  ACGAAACCGATGCCCGTGCTCAATTGGAATCGGGCCGGACCACACCCACTCTTCTGTTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     61  ACGAAACCGATGCCCGTGCTCAATTGGAATCGGGCCGGACCACACCCACTCTTCTGTTGC 120


13994R-2.IR_full       121 GCCTCGAACATCCGCGGAATGAACGCCGGGTGGCCTTTCACGCTGGGATCATCGACAACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     121 GCCTCGAACATCCGCGGAATGAACGCCGGGTGGCCTTTCACGCTGGGATCATCGACAACG 180


13994R-2.IR_full       181 AGCATTTGAATCGCAAGAAGTCCAAATGCTGCTGCATTTACAAAAAACCTCTCGCGTTCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     181 AGCATTTGAATCGCAAGAAGTCCAAATGCTGCTGCATTTACAAAAAACCTCTCGCGTTCG 240


13994R-2.IR_full       241 GCGAGAGCTCCTTCTGAGGATGACGAAGACTGTGAGCACTGCTTTGGACATCCGGAAAAG 300
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     241 GCGAGAGCTCC-TCTGAGGATGACGAAGACTGTGAGCACTGCTTTGGACATCCGGAAAAG 300


13994R-2.IR_full       301 CGTCAGAGAAACGCAAAACACAATCACAATCACGGGGACAAACCATGCACGGAGGNGTCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
13994R-2.in silico     301 CGTCAGAGAAACGCAAAACACAATCACAATCACGGGGACAAACCATGCACGGAGGCGTCG 360


13994R-2.IR_full       361 CATCCGGAAGGACCTTTCGACATCAACGCAGGCCGCGCACATCAGTCAACCGCCAGCCGA 420
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     361 CATCCGGAAGGACC-TTCGACATCAACGCAGGCCGCGCACATCAGTCAACCGCCAGCCGA 420


13994R-2.IR_full       421 GCCTGTTGAATCGAAGACCGATCCAAAACCACCTACCCCAGGTGTTGACTTTGAGCAGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13994R-2.in silico     421 GCCTGTTGAATCGAAGACCGATCCAAAACCACCTACCCCAGGTGTTGACTTTGAGCAGAC 480


13994R-2.IR_full       481 GGGCAGCTCG 490
                           ||||||||||
13994R-2.in silico     481 GGGCAGCTCG 490

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   470  NM_135144.2  CG13994-RA (CG13994), mRNA 
0   NM_139473.2  CG16985-RA (CG16985), mRNA 
0   NM_168395.1  CG32054-RA (CG32054), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_079065.3  CG15113-RA (5-HT1B), mRNA 
0   NM_136673.2  CG1698-RA (CG1698), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   NM_079683.2  CG4550-RA (ninaE), mRNA 
0   NM_142229.2  CG4525-RA (CG4525), mRNA 
0   14  NM_167716.2  CG11233-RA (l(1)19Ec), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_137833.1  CG4610-RA (CG4610), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_079137.2  CG3533-RA (uzip), mRNA 
0   NM_135933.2  CG4891-RA (CG4891), mRNA 
0   NM_137795.1  CG6613-RA (CG6613), mRNA 
0   NM_001014658.1  CG10693-RJ, transcript variant J (slo), mRNA 
0   NM_001014659.1  CG10693-RI, transcript variant I (slo), mRNA 
0   NM_137943.2  CG3493-RA (CG3493), mRNA 
0   NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
0   NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
0   NM_141679.1  CG12948-RA (CG12948), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_132981.1  CG8675-RA (CG8675), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.