National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13978R-1 
 Symbol CG13978  Full Name CG13978 
 CG No CG13978  Old CG No CG13978 
 Synonyms CG13978 
 Accession No (Link to NCBI) NM_143305.2 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGTTGATGGGCGCCATCTTG 
 Primer Seq. 3'
aatctagaggtaccACCTTATCGAAGGCCCATTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGTTGATGG GCGCCATCTT GAACACATAC TTCCAACACA CTCTACTGCC CAACCTCGTG 
0061 CCCCAAAAGA CGATGCGCGA ATTGGGCCTA GAACCTCCAG CGGATCGATT GGTGGTATTT 
0121 GTGACCGATG GTCTGCGTGC GGCCACCTTT CTGGCGAACA ATGGCAGCGA TGTTCCGGAT 
0181 CTGAAGGATA TATACCGGCA GCAGGGACGA ATTGGAATAT CCCGCACTTG TGCGCCGACA 
0241 ATGACACGAC CTGGACACAT AGCCATATTT GCCGGCTTCC ATGAAGATCC AGCTGCTTCT 
0301 TTGATGCATT TATGCTACAA TCCCGGCGAT TTCGATACCG TCTTCAATCG CAGCAGAAAT 
0361 ATGATCGGCT GGGCCCACAG CTACATTGTC GGTTATTTCG TAAAACTGTC GCATGGTGGT 
0421 GCCCCATTGA GATTTGACTC ATATATGGAA AGGGACCTGC CAGAAAAGCT GACATGTGAC 
0481 AAATGGGCCT TCGATAAGGT  
 in silico PCR Fragment
0001 TTGTTGATGG GCGCCATCTT GAACACATAC TTCCAACACA CTCTACTGCC CAACCTCGTG 
0061 CCCCAAAAGA CGATGCGCGA ATTGGGCCTA GAACCTCCAG CGGATCGATT GGTGGTATTT 
0121 GTGACCGATG GTCTGCGTGC GGCCACCTTT CTGGCGAACA ATGGCAGCGA TGTTCCGGAT 
0181 CTGAAGGATA TATACCGGCA GCAGGGACGA ATTGGAATAT CCCGCACTTG TGCGCCGACA 
0241 ATGACACGAC CTGGACACAT AGCCATATTT GCCGGCTTCC ATGAAGATCC AGCTGCTTCT 
0301 TTGATGCATT TATGCTACAA TCCCGGCGAT TTCGATACCG TCTTCAATCG CAGCAGAAAT 
0361 ATGATCGGCT GGGCCCACAG CTACATTGTC GGTTATTTCG TAAAACTGTC GCATGGTGGT 
0421 GCCCCATTGA GATTTGACTC ATATATGGAA AGGGACCTGC CAGAAAAGCT GACATGTGAC 
0481 AAATGGGCCT TCGATAAGGT  
 Assemble Data

13978R-1.IR_full       1   TTGTTGATGGGCGCCATCTTGAACACATACTTCCAACACACTCTACTGCCCAACCTCGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     1   TTGTTGATGGGCGCCATCTTGAACACATACTTCCAACACACTCTACTGCCCAACCTCGTG 60


13978R-1.IR_full       61  CCCCAAAAGACGATGCGCGAATTGGGCCTAGAACCTCCAGCGGATCGATTGGTGGTATTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     61  CCCCAAAAGACGATGCGCGAATTGGGCCTAGAACCTCCAGCGGATCGATTGGTGGTATTT 120


13978R-1.IR_full       121 GTGACCGATGGTCTGCGTGCGGCCACCTTTCTGGCGAACAATGGCAGCGATGTTCCGGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     121 GTGACCGATGGTCTGCGTGCGGCCACCTTTCTGGCGAACAATGGCAGCGATGTTCCGGAT 180


13978R-1.IR_full       181 CTGAAGGATATATACCGGCAGCAGGGACGAATTGGAATATCCCGCACTTGTGCGCCGACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     181 CTGAAGGATATATACCGGCAGCAGGGACGAATTGGAATATCCCGCACTTGTGCGCCGACA 240


13978R-1.IR_full       241 ATGACACGACCTGGACACATAGCCATATTTGCCGGCTTCCATGAAGATCCAGCTGCTTCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     241 ATGACACGACCTGGACACATAGCCATATTTGCCGGCTTCCATGAAGATCCAGCTGCTTCT 300


13978R-1.IR_full       301 TTGATGCATTTATGCTACAATCCCGGCGATTTCGATACCGTCTTCAATCGCAGCAGAAAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     301 TTGATGCATTTATGCTACAATCCCGGCGATTTCGATACCGTCTTCAATCGCAGCAGAAAT 360


13978R-1.IR_full       361 ATGATCGGCTGGGCCCACAGCTACATTGTCGGTTATTTCGTAAAACTGTCGCATGGTGGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     361 ATGATCGGCTGGGCCCACAGCTACATTGTCGGTTATTTCGTAAAACTGTCGCATGGTGGT 420


13978R-1.IR_full       421 GCCCCATTGAGATTTGACTCATATATGGAAAGGGACCTGCCAGAAAAGCTGACATGTGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13978R-1.in silico     421 GCCCCATTGAGATTTGACTCATATATGGAAAGGGACCTGCCAGAAAAGCTGACATGTGAC 480


13978R-1.IR_full       481 AAATGGGCCTTCGATAAGGT 500
                           ||||||||||||||||||||
13978R-1.in silico     481 AAATGGGCCTTCGATAAGGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143305.2  CG13978-RA (CG13978), mRNA 
0   NM_078655.2  CG4742-RA (mRpL22), mRNA 
0   NM_142151.1  CG3837-RA (CG3837), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_001015499.1  CG40444-PA.3 (CG40444), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_137328.2  CG9010-RA (CG9010), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   10  35  NM_142829.1  CG4907-RA (CG4907), mRNA 
0   NM_132598.2  CG3989-RA (ade5), mRNA 
0   NM_135746.2  CG5792-RA, transcript variant A (CG5792), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_141097.2  CG14569-RA (CG14569), mRNA 
0   10  NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   10  NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   NM_057377.3  CG9949-RA, transcript variant A (sina), mRNA 
0   NM_141732.1  CG3999-RA (CG3999), mRNA 
0   NM_168689.1  CG9949-RB, transcript variant B (sina), mRNA 
0   NM_137338.1  CG9642-RA (CG9642), mRNA 
0   NM_167324.1  CG32653-RA (CG32653), mRNA 
0   NM_132518.1  CG9360-RA (CG9360), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   11  NM_136705.1  CG2292-RA (CG2292), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_137150.2  CG10209-RA (CG10209), mRNA 
0   NM_137943.2  CG3493-RA (CG3493), mRNA 
0   NM_001038797.1  CG34059-RA (ppk16), mRNA 
0   NM_135641.2  CG4705-RA, transcript variant A (CG4705), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.