National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13912R-2 
 Symbol CG13912  Full Name CG13912 
 CG No CG13912  Old CG No CG13912 
 Synonyms CG13912 
 Accession No (Link to NCBI) NM_138235.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGATGTCACATACTGTGAGGGTCTTCAAGATGATGTACATTGTGGCGGGCATCCTCATCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAATGCGGAGATCTGCGACACAGTGGACCGCATCCAGATAGCGCCACGCGTCGACCTCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCCGGAATACGATCACAGGTACTTGACCTCCGGAGGCAATAGTCCCGGCTCCCGATCCC 180

                           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     181 GCACCCACTCTCGACAGAATTCCGGAAGTGGATCCGGATCGGAGGAA-GGATCCCCCACC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGAGGCGGAGAGTCAGCGTTTCCGGTATCGCGGGGGGCGTGGTCAGGGGCGTCACTAGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGGTCACCAAGAGAGTGGGCCACCGCTTCGTCTGGCTATCCGACATCCGGCTCATTCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGCAATGGCGACTCCTGGCCCTCAGCTTCAACCTCTGGACCATTCCCAACTTCTTGGTG 420

                           ||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGTGCCTCACCAGCTACATGAGCAAGAAGCTGCTCATCAATAGCGA 467

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   448  NM_138235.1  CG13912-RA (CG13912), mRNA 
0   11  NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_136625.2  CG8027-RA (CG8027), mRNA 
0   NM_140210.1  CG6140-RA (CG6140), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_166667.1  CG3411-RA (bs), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_132051.1  CG3726-RA (CG3726), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_168213.1  CG32379-RA (CG32379), mRNA 
0   NM_134645.2  CG11376-RA (CG11376), mRNA 
0   NM_141614.1  CG16735-RA (CG16735), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   NM_140001.2  CG13311-RA (CG13311), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_143720.2  CG6773-RA (sec13), mRNA 
0   NM_169887.1  CG4390-RB, transcript variant B (CG4390), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.