National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13912R-2 
 Symbol CG13912  Full Name CG13912 
 CG No CG13912  Old CG No CG13912 
 Synonyms CG13912 
 Accession No (Link to NCBI) NM_138235.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGATGTCACATACTGTGAGGG 
 Primer Seq. 3'
aatctagaggtaccTCGCTATTGATGAGCAGCTTC 
 Predicted Fragment Size
466 
 IR fragment full Seq
0001 TGATGTCACA TACTGTGAGG GTCTTCAAGA TGATGTACAT TGTGGCGGGC ATCCTCATCA 
0061 GCAATGCGGA GATCTGCGAC ACAGTGGACC GCATCCAGAT AGCGCCACGC GTCGACCTCA 
0121 AGCCGGAATA CGATCACAGG TACTTGACCT CCGGAGGCAA TAGTCCCGGC TCCCGATCCC 
0181 GCACCCACTC TCGACAGAAT TCCGGAAGTG GATCCGGATC GGAGGAANGG ATCCCCCACC 
0241 AAGAGGCGGA GAGTCAGCGT TTCCGGTATC GCGGGGGGCG TGGTCAGGGG CGTCACTAGC 
0301 CAGGTCACCA AGAGAGTGGG CCACCGCTTC GTCTGGCTAT CCGACATCCG GCTCATTCTC 
0361 CGGCAATGGC GACTCCTGGC CCTCAGCTTC AACCTCTGGA CCATTCCCAA CTTCTTGGTG 
0421 CAGTGCCTCA CCAGCTACAT GAGCAAGAAG CTGCTCATCA ATAGCGA 
 in silico PCR Fragment
0001 TGATGTCACA TACTGTGAGG GTCTTCAAGA TGATGTACAT TGTGGCGGGC ATCCTCATCA 
0061 GCAATGCGGA GATCTGCGAC ACAGTGGACC GCATCCAGAT AGCGCCACGC GTCGACCTCA 
0121 AGCCGGAATA CGATCACAGG TACTTGACCT CCGGAGGCAA TAGTCCCGGC TCCCGATCCC 
0181 GCACCCACTC TCGACAGAAT TCCGGAAGTG GATCCGGATC GGAGGAA-GG ATCCCCCACC 
0241 AAGAGGCGGA GAGTCAGCGT TTCCGGTATC GCGGGGGGCG TGGTCAGGGG CGTCACTAGC 
0301 CAGGTCACCA AGAGAGTGGG CCACCGCTTC GTCTGGCTAT CCGACATCCG GCTCATTCTC 
0361 CGGCAATGGC GACTCCTGGC CCTCAGCTTC AACCTCTGGA CCATTCCCAA CTTCTTGGTG 
0421 CAGTGCCTCA CCAGCTACAT GAGCAAGAAG CTGCTCATCA ATAGCGA 
 Assemble Data

13912R-2.IR_full       1   TGATGTCACATACTGTGAGGGTCTTCAAGATGATGTACATTGTGGCGGGCATCCTCATCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     1   TGATGTCACATACTGTGAGGGTCTTCAAGATGATGTACATTGTGGCGGGCATCCTCATCA 60


13912R-2.IR_full       61  GCAATGCGGAGATCTGCGACACAGTGGACCGCATCCAGATAGCGCCACGCGTCGACCTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     61  GCAATGCGGAGATCTGCGACACAGTGGACCGCATCCAGATAGCGCCACGCGTCGACCTCA 120


13912R-2.IR_full       121 AGCCGGAATACGATCACAGGTACTTGACCTCCGGAGGCAATAGTCCCGGCTCCCGATCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     121 AGCCGGAATACGATCACAGGTACTTGACCTCCGGAGGCAATAGTCCCGGCTCCCGATCCC 180


13912R-2.IR_full       181 GCACCCACTCTCGACAGAATTCCGGAAGTGGATCCGGATCGGAGGAANGGATCCCCCACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
13912R-2.in silico     181 GCACCCACTCTCGACAGAATTCCGGAAGTGGATCCGGATCGGAGGAA-GGATCCCCCACC 240


13912R-2.IR_full       241 AAGAGGCGGAGAGTCAGCGTTTCCGGTATCGCGGGGGGCGTGGTCAGGGGCGTCACTAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     241 AAGAGGCGGAGAGTCAGCGTTTCCGGTATCGCGGGGGGCGTGGTCAGGGGCGTCACTAGC 300


13912R-2.IR_full       301 CAGGTCACCAAGAGAGTGGGCCACCGCTTCGTCTGGCTATCCGACATCCGGCTCATTCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     301 CAGGTCACCAAGAGAGTGGGCCACCGCTTCGTCTGGCTATCCGACATCCGGCTCATTCTC 360


13912R-2.IR_full       361 CGGCAATGGCGACTCCTGGCCCTCAGCTTCAACCTCTGGACCATTCCCAACTTCTTGGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     361 CGGCAATGGCGACTCCTGGCCCTCAGCTTCAACCTCTGGACCATTCCCAACTTCTTGGTG 420


13912R-2.IR_full       421 CAGTGCCTCACCAGCTACATGAGCAAGAAGCTGCTCATCAATAGCGA 467
                           |||||||||||||||||||||||||||||||||||||||||||||||
13912R-2.in silico     421 CAGTGCCTCACCAGCTACATGAGCAAGAAGCTGCTCATCAATAGCGA 467

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   448  NM_138235.1  CG13912-RA (CG13912), mRNA 
0   11  NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_136625.2  CG8027-RA (CG8027), mRNA 
0   NM_140210.1  CG6140-RA (CG6140), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_166667.1  CG3411-RA (bs), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_132051.1  CG3726-RA (CG3726), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_168213.1  CG32379-RA (CG32379), mRNA 
0   NM_134645.2  CG11376-RA (CG11376), mRNA 
0   NM_141614.1  CG16735-RA (CG16735), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   NM_140001.2  CG13311-RA (CG13311), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_143720.2  CG6773-RA (sec13), mRNA 
0   NM_169887.1  CG4390-RB, transcript variant B (CG4390), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.