National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13894R-3 
 Symbol CG13894  Full Name CG13894 
 CG No CG13894  Old CG No CG13894 
 Synonyms dmCG13894, CG13894 
 Accession No (Link to NCBI) NM_138210.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAATTCGCGTCAGCACCCGAGTATGCAGTTCTTTGCGTTTCCCCGGCCGGAGAACCCCTT 60

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     61  CCACAAGCTGTGGAAGGAGGCGTGCCACGCCTCCCT-AAGACGAATTGTGCCCTTCAAAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     121 AGCCAGTGGTATGTGCCCTGCACTTTGACCCCAGTGTCTTGGGTGGCAGGCGACTGCAGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGAATGCGCTGCCCACCCTGCGTCTGGAAGTTCCCTCCAACCTGGAGGCCGTTGAGCAGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGCCATGGTGGAGGAGATCGAGAGGAGCCGAAAGTGCGCCTACATCAATGCAGTGGTAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGAATGGCTAGTAAGGGCCAATATCAATCCCCAGCTGCGAGGTAGCATTACCCACGGAA 360

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     361 TGATCAAGGACAAGGCGGAGAATGCCAGACAAGTCATAGGGAGCACATCCTTTATAGCAG 420

                           ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| silico     421 ACAATCGCTGGTTAAACCGTTTCCGAGAGACTCATCTTCAAGGCTTTGCCCAAAAACTAG 480

13894R-3.IR_full       481 CCAGCAACCAGTTGAAGNCAC 501
                           ||||||||||||||||| ||| silico     481 CCAGCAACCAGTTGAAGCCAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138210.1  CG13894-RA (CG13894), mRNA 
0.41   NM_143465.1  CG1973-RA (CG1973), mRNA 
0   NM_169148.3  CG2336-RA (CG2336), mRNA 
0   NM_135697.1  CG14945-RA, transcript variant A (CG14945), mRNA 
0   NM_164987.1  CG14945-RB, transcript variant B (CG14945), mRNA 
0   NM_142146.1  CG14860-RA (CG14860), mRNA 
0   11  14  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_164863.1  CG31884-RB, transcript variant B (Trx-2), mRNA 
0   NM_078802.2  CG31884-RA, transcript variant A (Trx-2), mRNA 
0   NM_166411.1  CG8994-RB, transcript variant B (exu), mRNA 
0   NM_166410.1  CG8994-RA, transcript variant A (exu), mRNA 
0   NM_166412.1  CG8994-RC, transcript variant C (exu), mRNA 
0   NM_142397.1  CG14318-RA (CG14318), mRNA 
0   NM_142456.1  CG15803-RA (CG15803), mRNA 
0   NM_134603.1  CG1489-RA (Pros45), mRNA 
0   NM_140791.2  CG6897-RA (CG6897), mRNA 
0   NM_135332.2  CG7380-RA (CG7380), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_140060.1  CG3445-RA (phol), mRNA 
0   12  NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   12  NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
0   NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0   NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
0   NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.