National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13894R-1 
 Symbol CG13894  Full Name CG13894 
 CG No CG13894  Old CG No CG13894 
 Synonyms dmCG13894, CG13894 
 Accession No (Link to NCBI) NM_138210.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAATTCGCGTCAGCACCCGAG 
 Primer Seq. 3'
aatctagaggtaccGTGGCTTCAACTGGTTGCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAATTCGCGN CAGcaCCCGA GTATGCAGTT CTTTGCGTTT CCCCGGCCGG AGAACCCCTT 
0061 CCACAAGCTG TGGAAGGAGG CGTGCCACGC CTCCCTAAAG ACGAATTGTG CCCTTCAAAA 
0121 AGCCAGTGGT ATGTGCCCTG CACTTTGACC CCAGTGTCTT GGGTGGTAGG CGACTGCAGT 
0181 CGAATGCGCT GCCCACCCTG CGTCTGGAAG TTCCCTCCAA CCTGGAGGCC GTTGAGCAGC 
0241 AGGCCATGGT GGAGGAGATC GAGAGGAGCC GAAAGTGCGC CTACATCAAT GCAGTGGTAT 
0301 ACGAATGGCT AGTAAGGGCC AATATCAATC CCCAGCTGCG AGGTAGCATT ACCCACGGAA 
0361 TGATCAAGGA CAAGGCGGAG AATGCCCGAC AAGTCATAGG GAGCACATCC TTTATAGCAG 
0421 ACAATCGCTG GTTAAACCGT TTCCGAGAGA CTCATCTTca aNGNTTTGCC CAAAAACTAG 
0481 CCAGCAACCA GTTGAAgNCA C 
 in silico PCR Fragment
0001 CAATTCGCGT CAGCACCCGA GTATGCAGTT CTTTGCGTTT CCCCGGCCGG AGAACCCCTT 
0061 CCACAAGCTG TGGAAGGAGG CGTGCCACGC CTCCCT-AAG ACGAATTGTG CCCTTCAAAA 
0121 AGCCAGTGGT ATGTGCCCTG CACTTTGACC CCAGTGTCTT GGGTGGCAGG CGACTGCAGT 
0181 CGAATGCGCT GCCCACCCTG CGTCTGGAAG TTCCCTCCAA CCTGGAGGCC GTTGAGCAGC 
0241 AGGCCATGGT GGAGGAGATC GAGAGGAGCC GAAAGTGCGC CTACATCAAT GCAGTGGTAT 
0301 ACGAATGGCT AGTAAGGGCC AATATCAATC CCCAGCTGCG AGGTAGCATT ACCCACGGAA 
0361 TGATCAAGGA CAAGGCGGAG AATGCCAGAC AAGTCATAGG GAGCACATCC TTTATAGCAG 
0421 ACAATCGCTG GTTAAACCGT TTCCGAGAGA CTCATCTTCA AGGCTTTGCC CAAAAACTAG 
0481 CCAGCAACCA GTTGAAGCCA C 
 Assemble Data

13894R-1.IR_full       1   CAATTCGCGNCAGCACCCGAGTATGCAGTTCTTTGCGTTTCCCCGGCCGGAGAACCCCTT 60
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13894R-1.in silico     1   CAATTCGCGTCAGCACCCGAGTATGCAGTTCTTTGCGTTTCCCCGGCCGGAGAACCCCTT 60


13894R-1.IR_full       61  CCACAAGCTGTGGAAGGAGGCGTGCCACGCCTCCCTAAAGACGAATTGTGCCCTTCAAAA 120
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
13894R-1.in silico     61  CCACAAGCTGTGGAAGGAGGCGTGCCACGCCTCCCT-AAGACGAATTGTGCCCTTCAAAA 120


13894R-1.IR_full       121 AGCCAGTGGTATGTGCCCTGCACTTTGACCCCAGTGTCTTGGGTGGTAGGCGACTGCAGT 180
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
13894R-1.in silico     121 AGCCAGTGGTATGTGCCCTGCACTTTGACCCCAGTGTCTTGGGTGGCAGGCGACTGCAGT 180


13894R-1.IR_full       181 CGAATGCGCTGCCCACCCTGCGTCTGGAAGTTCCCTCCAACCTGGAGGCCGTTGAGCAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13894R-1.in silico     181 CGAATGCGCTGCCCACCCTGCGTCTGGAAGTTCCCTCCAACCTGGAGGCCGTTGAGCAGC 240


13894R-1.IR_full       241 AGGCCATGGTGGAGGAGATCGAGAGGAGCCGAAAGTGCGCCTACATCAATGCAGTGGTAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13894R-1.in silico     241 AGGCCATGGTGGAGGAGATCGAGAGGAGCCGAAAGTGCGCCTACATCAATGCAGTGGTAT 300


13894R-1.IR_full       301 ACGAATGGCTAGTAAGGGCCAATATCAATCCCCAGCTGCGAGGTAGCATTACCCACGGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13894R-1.in silico     301 ACGAATGGCTAGTAAGGGCCAATATCAATCCCCAGCTGCGAGGTAGCATTACCCACGGAA 360


13894R-1.IR_full       361 TGATCAAGGACAAGGCGGAGAATGCCCGACAAGTCATAGGGAGCACATCCTTTATAGCAG 420
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
13894R-1.in silico     361 TGATCAAGGACAAGGCGGAGAATGCCAGACAAGTCATAGGGAGCACATCCTTTATAGCAG 420


13894R-1.IR_full       421 ACAATCGCTGGTTAAACCGTTTCCGAGAGACTCATCTTCAANGNTTTGCCCAAAAACTAG 480
                           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
13894R-1.in silico     421 ACAATCGCTGGTTAAACCGTTTCCGAGAGACTCATCTTCAAGGCTTTGCCCAAAAACTAG 480


13894R-1.IR_full       481 CCAGCAACCAGTTGAAGNCAC 501
                           ||||||||||||||||| |||
13894R-1.in silico     481 CCAGCAACCAGTTGAAGCCAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138210.1  CG13894-RA (CG13894), mRNA 
0.41   NM_143465.1  CG1973-RA (CG1973), mRNA 
0   NM_169148.3  CG2336-RA (CG2336), mRNA 
0   NM_135697.1  CG14945-RA, transcript variant A (CG14945), mRNA 
0   NM_164987.1  CG14945-RB, transcript variant B (CG14945), mRNA 
0   NM_142146.1  CG14860-RA (CG14860), mRNA 
0   11  14  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_164863.1  CG31884-RB, transcript variant B (Trx-2), mRNA 
0   NM_078802.2  CG31884-RA, transcript variant A (Trx-2), mRNA 
0   NM_166411.1  CG8994-RB, transcript variant B (exu), mRNA 
0   NM_166410.1  CG8994-RA, transcript variant A (exu), mRNA 
0   NM_166412.1  CG8994-RC, transcript variant C (exu), mRNA 
0   NM_142397.1  CG14318-RA (CG14318), mRNA 
0   NM_142456.1  CG15803-RA (CG15803), mRNA 
0   NM_134603.1  CG1489-RA (Pros45), mRNA 
0   NM_140791.2  CG6897-RA (CG6897), mRNA 
0   NM_135332.2  CG7380-RA (CG7380), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_140060.1  CG3445-RA (phol), mRNA 
0   12  NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   12  NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
0   NM_167005.1  CG3665-RC, transcript variant C (Fas2), mRNA 
0   NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0   NM_167004.1  CG3665-RB, transcript variant B (Fas2), mRNA 
0   NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.