National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13807R-2 
 Symbol CG13807  Full Name CG13807 
 CG No CG13807  Old CG No CG13807 
 Synonyms CG13807 
 Accession No (Link to NCBI) NM_139449.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCAACCGAAAGATAAACCGT 
 Primer Seq. 3'
aatctagaggtaccCCTTGGATGCAGGCACAAAGT 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CCCAACCGAA AGATAAACCG TCTGGTCGAA AGGGACCTGA ACTTCCTGGA GTCCTGCGAG 
0061 CTTGAGTTCG CAGACCGCTT CACTGACGAC GACCCAGAGT TCATGGCGCA CTGCAGCANA 
0121 GCCTGTGCCG GAGCCGCCAA TTGTGGAGAA CTGGATGGGA GGTGGCGGAG GAGGAGGCGG 
0181 CTTCCAGGGC GGAGGAGGCG GTGGTCATCC CTACCACAAT CGCTACAACG GACATCGCAG 
0241 AGGAGGCGGC GACAGGGGCT GGCAGCGACG AGGAGGAGCT GGCTACCACA ACAACCAGGA 
0301 CAGGGGATTC AGGGACAACC GGCGCAACAA CAGATACGAT CACATCGATC GCCGGAATCG 
0361 GTACGAAGGA GGCGGAGGGT CTGGAGGATC TGGAGGCTAC AAGCGCTCCC ATGATCATAA 
0421 CCAGAGAAAT GATACTCCCA ATAACAACCC ACCCATGAAG GTCAGACGCG ACTATGGAAA 
0481 CTTTGTGCCT GCATCCAAGG  
 in silico PCR Fragment
0001 CCCAACCGAA AGATAAACCG TCTGGTCGAA AGGGACCTGA ACTTCCTGGA GTCCTGCGAG 
0061 CTTGAGTTCG CAGACCGCTT CACTGACGAC GACCCAGAGT TCATGGCGCA CTGCAGCA-A 
0121 GCCTGTGCCG GAGCCGCCAA TTGTGGAGAA CTGGATGGGA GGTGGCGGAG GAGGAGGCGG 
0181 CTTCCAGGGC GGAGGAGGCG GTGGTCATCC CTACCACAAT CGCTACAACG GACATCGCAG 
0241 AGGAGGCGGC GACAGGGGCT GGCAGCGACG AGGAGGAGCT GGCTACCACA ACAACCAGGA 
0301 CAGGGGATTC AGGGACAACC GGCGCAACAA CAGATACGAT CACATCGATC GCCGGAATCG 
0361 GTACGAAGGA GGCGGAGGGT CCGGAGGATC TGGAGGCTAC AAGCGCTCCC ATGATCATAA 
0421 CCAGAGAAAT GATACTCCCA ATAACGAACC ACCCATGAAG GTCAGACGCG ACTATGGAAA 
0481 CTTTGTGCCT GCATCCAAGG  
 Assemble Data

13807R-2.IR_full       1   CCCAACCGAAAGATAAACCGTCTGGTCGAAAGGGACCTGAACTTCCTGGAGTCCTGCGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     1   CCCAACCGAAAGATAAACCGTCTGGTCGAAAGGGACCTGAACTTCCTGGAGTCCTGCGAG 60


13807R-2.IR_full       61  CTTGAGTTCGCAGACCGCTTCACTGACGACGACCCAGAGTTCATGGCGCACTGCAGCANA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
13807R-2.in silico     61  CTTGAGTTCGCAGACCGCTTCACTGACGACGACCCAGAGTTCATGGCGCACTGCAGCA-A 120


13807R-2.IR_full       121 GCCTGTGCCGGAGCCGCCAATTGTGGAGAACTGGATGGGAGGTGGCGGAGGAGGAGGCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     121 GCCTGTGCCGGAGCCGCCAATTGTGGAGAACTGGATGGGAGGTGGCGGAGGAGGAGGCGG 180


13807R-2.IR_full       181 CTTCCAGGGCGGAGGAGGCGGTGGTCATCCCTACCACAATCGCTACAACGGACATCGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     181 CTTCCAGGGCGGAGGAGGCGGTGGTCATCCCTACCACAATCGCTACAACGGACATCGCAG 240


13807R-2.IR_full       241 AGGAGGCGGCGACAGGGGCTGGCAGCGACGAGGAGGAGCTGGCTACCACAACAACCAGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     241 AGGAGGCGGCGACAGGGGCTGGCAGCGACGAGGAGGAGCTGGCTACCACAACAACCAGGA 300


13807R-2.IR_full       301 CAGGGGATTCAGGGACAACCGGCGCAACAACAGATACGATCACATCGATCGCCGGAATCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     301 CAGGGGATTCAGGGACAACCGGCGCAACAACAGATACGATCACATCGATCGCCGGAATCG 360


13807R-2.IR_full       361 GTACGAAGGAGGCGGAGGGTCTGGAGGATCTGGAGGCTACAAGCGCTCCCATGATCATAA 420
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
13807R-2.in silico     361 GTACGAAGGAGGCGGAGGGTCCGGAGGATCTGGAGGCTACAAGCGCTCCCATGATCATAA 420


13807R-2.IR_full       421 CCAGAGAAATGATACTCCCAATAACAACCCACCCATGAAGGTCAGACGCGACTATGGAAA 480
                           ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||
13807R-2.in silico     421 CCAGAGAAATGATACTCCCAATAACGAACCACCCATGAAGGTCAGACGCGACTATGGAAA 480


13807R-2.IR_full       481 CTTTGTGCCTGCATCCAAGG 500
                           ||||||||||||||||||||
13807R-2.in silico     481 CTTTGTGCCTGCATCCAAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_139449.1  CG13807-RA (CG13807), mRNA 
0.41   17  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0.41   17  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0.41   16  NM_136895.2  CG13176-RA (CG13176), mRNA 
0.41   11  NM_079117.2  CG3385-RA (nvy), mRNA 
0.2   NM_140926.1  CG13811-RA (CG13811), mRNA 
0.2   15  NM_078797.2  CG13109-RA (tai), mRNA 
0.2   11  NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0.2   11  NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0.2   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0.2   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0.2   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0.2   NM_176129.3  CG12052-RO, transcript variant O (lola), mRNA 
0   24  55  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   12  30  NM_136060.1  CG10348-RA (CG10348), mRNA 
0   10  18  NM_142649.2  CG4000-RA (CG4000), mRNA 
0   13  NM_164744.1  CG4675-RB, transcript variant B (Ndae1), mRNA 
0   14  NM_138132.1  CG9083-RA (CG9083), mRNA 
0   15  31  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   15  31  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   15  31  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   15  31  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   13  24  NM_168575.1  CG32138-RA, transcript variant A (CG32138), mRNA 
0   13  24  NM_168576.1  CG32138-RB, transcript variant B (CG32138), mRNA 
0   12  NM_132734.2  CG9411-RA (CG9411), mRNA 
0   32  NM_132536.1  CG1840-RA (CG1840), mRNA 
0   14  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   13  NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0   NM_143225.2  CG6490-RA (CG6490), mRNA 
0   NM_141040.1  CG7752-RA (Z4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.