National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13806R-3 
 Symbol CG13806  Full Name CG13806 
 CG No CG13806  Old CG No CG13806 
 Synonyms CG13806 
 Accession No (Link to NCBI) NM_139451.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTTATGGGAGCCACTGTTA 
 Primer Seq. 3'
aatctagaggtaccGCACACGTAGAAGATATTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCTTATGGG AGCCACTGTT ACCACCCGGC GCATCCAGCC GCGGGAGACA AACTCCTGCG 
0061 AGGGCCGTCA GAGTCCCGGG CCCATCTGCG AGTCCTGCGA GCTGCTGGCC ACCTGCGTGC 
0121 GTCACTCCAA CGGATGGGTG AACATTCCCG TGGAATCGTG CGACGTGGCC AATGGATACT 
0181 ACTGCAACGC CCGGCTGGGG AGCTGCACCA ACGAGACGGG CCCGTGTCAT CCGTTCGGCA 
0241 TCGAGGGCAA CTTTCAGTGC ACCTCGCAAG GCATCTTTCC AGATCCGTAC GACTGCCAGA 
0301 AGTACCACAT GTGCTACTTC GTGGGGGCCA CTCTGGTgGC TGCNTGCCGT TGATTGCGGC 
0361 AACGACAAGG CCTTCGATGC GACGACTGGC CAGTGCACTT TGACCCTGAC TGACTCCGTC 
0421 TGCCTGCAGC GACAGTACTA CTGCCCCAAT GCCGGACACG TGGCCGCCTG GCCCACCAAT 
0481 CCCAATATCT TCTACGTGTG C 
 in silico PCR Fragment
0001 TGCTTATGGG AGCCACTGTT ACCACCCGGC GCATCCAGCC GCGGGAGACA AACTCCTGCG 
0061 AGGGCCGTCA GAGTCCCGGG CCCATCTGCG AGTCCTGCGA GCTGCTGGCC ACCTGCGTGC 
0121 GTCACTCCAA CGGATGGGTG AACATTCCCG TGGAATCGTG CGACGTGGCT AATGGATACT 
0181 ACTGCAACGC CCGGCTGGGG AGCTGCACCA ACGAGACGGG CCCGTGTCAT CCGTTCGGCA 
0241 TCGAGGGCAA CTTTCAGTGC ACCTCGCAAG GCATCTTTCC AGATCCGTAC GACTGCCAGA 
0301 AGTACCACAT GTGCTACTTC GTGGGGGCCA CTCTGGTGGC TGC-TGCCGT TGATTGCGGC 
0361 AACGACAAGG CCTTCGATGC GACGACTGGC CAGTGCACTT TGACCCTGAC TGACTCCGTC 
0421 TGCCTGCAGC GACAGTACTA CTGCCCCAAT GCCGGACACG TGGCCGCCTG GCCCACCAAT 
0481 CCCAATATCT TCTACGTGTG C 
 Assemble Data

13806R-3.IR_full       1   TGCTTATGGGAGCCACTGTTACCACCCGGCGCATCCAGCCGCGGGAGACAAACTCCTGCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     1   TGCTTATGGGAGCCACTGTTACCACCCGGCGCATCCAGCCGCGGGAGACAAACTCCTGCG 60


13806R-3.IR_full       61  AGGGCCGTCAGAGTCCCGGGCCCATCTGCGAGTCCTGCGAGCTGCTGGCCACCTGCGTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     61  AGGGCCGTCAGAGTCCCGGGCCCATCTGCGAGTCCTGCGAGCTGCTGGCCACCTGCGTGC 120


13806R-3.IR_full       121 GTCACTCCAACGGATGGGTGAACATTCCCGTGGAATCGTGCGACGTGGCCAATGGATACT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
13806R-3.in silico     121 GTCACTCCAACGGATGGGTGAACATTCCCGTGGAATCGTGCGACGTGGCTAATGGATACT 180


13806R-3.IR_full       181 ACTGCAACGCCCGGCTGGGGAGCTGCACCAACGAGACGGGCCCGTGTCATCCGTTCGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     181 ACTGCAACGCCCGGCTGGGGAGCTGCACCAACGAGACGGGCCCGTGTCATCCGTTCGGCA 240


13806R-3.IR_full       241 TCGAGGGCAACTTTCAGTGCACCTCGCAAGGCATCTTTCCAGATCCGTACGACTGCCAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     241 TCGAGGGCAACTTTCAGTGCACCTCGCAAGGCATCTTTCCAGATCCGTACGACTGCCAGA 300


13806R-3.IR_full       301 AGTACCACATGTGCTACTTCGTGGGGGCCACTCTGGTGGCTGCNTGCCGTTGATTGCGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13806R-3.in silico     301 AGTACCACATGTGCTACTTCGTGGGGGCCACTCTGGTGGCTGC-TGCCGTTGATTGCGGC 360


13806R-3.IR_full       361 AACGACAAGGCCTTCGATGCGACGACTGGCCAGTGCACTTTGACCCTGACTGACTCCGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     361 AACGACAAGGCCTTCGATGCGACGACTGGCCAGTGCACTTTGACCCTGACTGACTCCGTC 420


13806R-3.IR_full       421 TGCCTGCAGCGACAGTACTACTGCCCCAATGCCGGACACGTGGCCGCCTGGCCCACCAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13806R-3.in silico     421 TGCCTGCAGCGACAGTACTACTGCCCCAATGCCGGACACGTGGCCGCCTGGCCCACCAAT 480


13806R-3.IR_full       481 CCCAATATCTTCTACGTGTGC 501
                           |||||||||||||||||||||
13806R-3.in silico     481 CCCAATATCTTCTACGTGTGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139451.1  CG13806-RA (CG13806), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_138142.3  CG2790-RA (CG2790), mRNA 
0   NM_143768.2  CG12286-RA (kar), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
0   NM_001031909.1  CG33517-RE, transcript variant E (D2R), mRNA 
0   NM_164453.3  CG7254-RA, transcript variant A (GlyP), mRNA 
0   NM_001032048.1  CG7254-RB, transcript variant B (GlyP), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   NM_057386.3  CG6137-RA (aub), mRNA 
0   NM_140700.2  CG7724-RA (CG7724), mRNA 
0   NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0   NM_139861.2  CG8562-RA (CG8562), mRNA 
0   NM_057669.2  CG12399-RA (Mad), mRNA 
0   NM_136798.1  CG30021-RA (skf), mRNA 
0   NM_132114.1  CG14442-RA (CG14442), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.