National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13806R-1 
 Symbol CG13806  Full Name CG13806 
 CG No CG13806  Old CG No CG13806 
 Synonyms CG13806 
 Accession No (Link to NCBI) NM_139451.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCTTATGGGAGCCACTGTTACCACCCGGCGCATCCAGCCGCGGGAGACAAACTCCTGCG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGGGCCGTCAGAGTCCCGGGCCCATCTGCGAGTCCTGCGAGCTGCTGGCCACCTGCGTGC 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     121 GTCACTCCAACGGATGGGTGAACATTCCCGTGGAATCGTGCGACGTGGCTAATGGATACT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTGCAACGCCCGGCTGGGGAGCTGCACCAACGAGACGGGCCCGTGTCATCCGTTCGGCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCGAGGGCAACTTTCAGTGCACCTCGCAAGGCATCTTTCCAGATCCGTACGACTGCCAGA 300

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     301 AGTACCACATGTGCTACTTCGTGGGGGCCACTCTGGTGGCTGC-TGCCGTTGATTGCGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACGACAAGGCCTTCGATGCGACGACTGGCCAGTGCACTTTGACCCTGACTGACTCCGTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCCTGCAGCGACAGTACTACTGCCCCAATGCCGGACACGTGGCCGCCTGGCCCACCAAT 480

13806R-1.IR_full       481 CCCAATATCTTCTACGTGTGC 501
                           ||||||||||||||||||||| silico     481 CCCAATATCTTCTACGTGTGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139451.1  CG13806-RA (CG13806), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_138142.3  CG2790-RA (CG2790), mRNA 
0   NM_143768.2  CG12286-RA (kar), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
0   NM_001031909.1  CG33517-RE, transcript variant E (D2R), mRNA 
0   NM_164453.3  CG7254-RA, transcript variant A (GlyP), mRNA 
0   NM_001032048.1  CG7254-RB, transcript variant B (GlyP), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   NM_057386.3  CG6137-RA (aub), mRNA 
0   NM_140700.2  CG7724-RA (CG7724), mRNA 
0   NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0   NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0   NM_139861.2  CG8562-RA (CG8562), mRNA 
0   NM_057669.2  CG12399-RA (Mad), mRNA 
0   NM_136798.1  CG30021-RA (skf), mRNA 
0   NM_132114.1  CG14442-RA (CG14442), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.