National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13762R-3 
 Symbol CG13762  Full Name CG13762 
 CG No CG13762  Old CG No CG13762 
 Synonyms EG:BACR7C10.7, CT33244, CG13762 
 Accession No (Link to NCBI) NM_130657.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CATCGCTGTGTTCGCCGGTTTCCAGCACGAGGACGTCAAGTTCAAGACGATGCTGGTGAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     61  CATTGTGATAGTGCTGATCTTCCAGTTCCTCATCGGTGACCCGATCAAGTTCGTTATCCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTCCATCGACCGGGCCCTGTGGCCACCGCGGATCTATATACCGCCGCGATGTGACAAGGA 180

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     181 TGAGATGGATGAGAAGGAGGAACGCAGGGACTTCCTCAAGCAGCGCCTGATTAACAAGCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCCAACCTGATGCTGACCTCGCGCTACAGGAACTATAAGCTCAACGATCAGTACAAGAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATCGCCCACGATCTCTTCATCTACGGCCCGTACTTTCTCTGCCTGATGTGCCTGGTGCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGTGACGAGGGATCAAACCCTCTACCACAACACTCGCATCATCACGGATCTGTTTATGTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAACCACACGGACTACACGGGCCTGCAGGAGGTGTACTTCCTCAACCAGCTGTTCGACTT 480

13762R-3.IR_full       481 CATCGAGTCCACTCTGGTGC 500
                           |||||||||||||||||||| silico     481 CATCGAGTCCACTCTGGTGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130657.2  CG13762-RA (CG13762), mRNA 
0.2   NM_132691.2  CG11130-RA (Rtc1), mRNA 
0.2   NM_139388.1  CG13930-RA (CG13930), mRNA 
0   NM_058151.4  CG6551-RA (fu), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_079535.2  CG1121-RA (alpha-Est8), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   NM_078661.3  CG8649-RA, transcript variant A (Fim), mRNA 
0   NM_167564.1  CG8649-RC, transcript variant C (Fim), mRNA 
0   NM_167565.1  CG8649-RD, transcript variant D (Fim), mRNA 
0   NM_001014606.1  CG1161-RB, transcript variant B (CG1161), mRNA 
0   NM_141271.2  CG1161-RA, transcript variant A (CG1161), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_079574.2  CG9474-RA (Snap24), mRNA 
0   NM_079580.2  CG6515-RA (Takr86C), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.