National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13762R-1 
 Symbol CG13762  Full Name CG13762 
 CG No CG13762  Old CG No CG13762 
 Synonyms EG:BACR7C10.7, CT33244, CG13762 
 Accession No (Link to NCBI) NM_130657.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat Cell Biol (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATCGCTGTGTTCGCCGGTTT 
 Primer Seq. 3'
aatctagaggtaccGCACCAGAGTGGACTCGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATCGCTGTG TTCGCCGGTT TCCAGCACGA GGACGTCAAG TTCAAGACGA TGCTGGTGAG 
0061 CATTGTGATA GTGCTGATCT TCCAGTTCCT CATCGGTGAC CCGATCAAGT TCGTGATCCT 
0121 GTCCATCGAC CGGGCCCTGT GGCCACCGCG GATCTATATA CCGCCGCGAT GTGACAAGGA 
0181 TGAGATGGAT GAGAAGGAGG AACGCAGGGA CTTCCTCAAG CAGCGTCTGA TTAACAAGCG 
0241 CGCCAACCTG ATGCTGACCT CGCGCTACAG GAACTATAAG CTCAACGATC AGTACAAGAT 
0301 GATCGCCCAC GATCTCTTCA TCTACGGCCC GTACTTTCTC TGCCTGATGT GCCTGGTGCT 
0361 GGTGACGAGG GATCAAACCC TCTACCACAA CACTCGCATC ATCACGGATC TGTTTATGTA 
0421 CAACCACACG GACTACACGG GCCTGCAGGA GGTGTACTTC CTCAACCAGC TGTTCGACTT 
0481 CATCGAGTCC ACTCTGGTGC  
 in silico PCR Fragment
0001 CATCGCTGTG TTCGCCGGTT TCCAGCACGA GGACGTCAAG TTCAAGACGA TGCTGGTGAG 
0061 CATTGTGATA GTGCTGATCT TCCAGTTCCT CATCGGTGAC CCGATCAAGT TCGTTATCCT 
0121 GTCCATCGAC CGGGCCCTGT GGCCACCGCG GATCTATATA CCGCCGCGAT GTGACAAGGA 
0181 TGAGATGGAT GAGAAGGAGG AACGCAGGGA CTTCCTCAAG CAGCGCCTGA TTAACAAGCG 
0241 CGCCAACCTG ATGCTGACCT CGCGCTACAG GAACTATAAG CTCAACGATC AGTACAAGAT 
0301 GATCGCCCAC GATCTCTTCA TCTACGGCCC GTACTTTCTC TGCCTGATGT GCCTGGTGCT 
0361 GGTGACGAGG GATCAAACCC TCTACCACAA CACTCGCATC ATCACGGATC TGTTTATGTA 
0421 CAACCACACG GACTACACGG GCCTGCAGGA GGTGTACTTC CTCAACCAGC TGTTCGACTT 
0481 CATCGAGTCC ACTCTGGTGC  
 Assemble Data

13762R-1.IR_full       1   CATCGCTGTGTTCGCCGGTTTCCAGCACGAGGACGTCAAGTTCAAGACGATGCTGGTGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     1   CATCGCTGTGTTCGCCGGTTTCCAGCACGAGGACGTCAAGTTCAAGACGATGCTGGTGAG 60


13762R-1.IR_full       61  CATTGTGATAGTGCTGATCTTCCAGTTCCTCATCGGTGACCCGATCAAGTTCGTGATCCT 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
13762R-1.in silico     61  CATTGTGATAGTGCTGATCTTCCAGTTCCTCATCGGTGACCCGATCAAGTTCGTTATCCT 120


13762R-1.IR_full       121 GTCCATCGACCGGGCCCTGTGGCCACCGCGGATCTATATACCGCCGCGATGTGACAAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     121 GTCCATCGACCGGGCCCTGTGGCCACCGCGGATCTATATACCGCCGCGATGTGACAAGGA 180


13762R-1.IR_full       181 TGAGATGGATGAGAAGGAGGAACGCAGGGACTTCCTCAAGCAGCGTCTGATTAACAAGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
13762R-1.in silico     181 TGAGATGGATGAGAAGGAGGAACGCAGGGACTTCCTCAAGCAGCGCCTGATTAACAAGCG 240


13762R-1.IR_full       241 CGCCAACCTGATGCTGACCTCGCGCTACAGGAACTATAAGCTCAACGATCAGTACAAGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     241 CGCCAACCTGATGCTGACCTCGCGCTACAGGAACTATAAGCTCAACGATCAGTACAAGAT 300


13762R-1.IR_full       301 GATCGCCCACGATCTCTTCATCTACGGCCCGTACTTTCTCTGCCTGATGTGCCTGGTGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     301 GATCGCCCACGATCTCTTCATCTACGGCCCGTACTTTCTCTGCCTGATGTGCCTGGTGCT 360


13762R-1.IR_full       361 GGTGACGAGGGATCAAACCCTCTACCACAACACTCGCATCATCACGGATCTGTTTATGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     361 GGTGACGAGGGATCAAACCCTCTACCACAACACTCGCATCATCACGGATCTGTTTATGTA 420


13762R-1.IR_full       421 CAACCACACGGACTACACGGGCCTGCAGGAGGTGTACTTCCTCAACCAGCTGTTCGACTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13762R-1.in silico     421 CAACCACACGGACTACACGGGCCTGCAGGAGGTGTACTTCCTCAACCAGCTGTTCGACTT 480


13762R-1.IR_full       481 CATCGAGTCCACTCTGGTGC 500
                           ||||||||||||||||||||
13762R-1.in silico     481 CATCGAGTCCACTCTGGTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130657.2  CG13762-RA (CG13762), mRNA 
0.2   NM_132691.2  CG11130-RA (Rtc1), mRNA 
0.2   NM_139388.1  CG13930-RA (CG13930), mRNA 
0   NM_058151.4  CG6551-RA (fu), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_079535.2  CG1121-RA (alpha-Est8), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   NM_078661.3  CG8649-RA, transcript variant A (Fim), mRNA 
0   NM_167564.1  CG8649-RC, transcript variant C (Fim), mRNA 
0   NM_167565.1  CG8649-RD, transcript variant D (Fim), mRNA 
0   NM_001014606.1  CG1161-RB, transcript variant B (CG1161), mRNA 
0   NM_141271.2  CG1161-RA, transcript variant A (CG1161), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_079574.2  CG9474-RA (Snap24), mRNA 
0   NM_079580.2  CG6515-RA (Takr86C), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.