National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13761R-3 
 Symbol Bzd  Full Name Buzidau 
 CG No CG13761  Old CG No CG13761 
 Synonyms CG13761, EG:BACR7C10.4, unnamed, Bzd 
 Accession No (Link to NCBI) NM_080029.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCGCCACCGTTGGTTCATC 
 Primer Seq. 3'
aatctagaggtaccTGAGGACGGCATGCAGCGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCGCCACC GTTGGTTCAT CCAGATCCGC AACCACATCC GCAACCGCAT CCGCATGCTC 
0061 ATCCAAATCC AAGAACCTAA AGAATCCGGC GCCGCAAATA AAAAGGGGAC AGCGGATCCT 
0121 CACGGAGAAA CCATTCGCCT TCGTCTTGAA ATCACAGTAC CGCCTGGAGC GGTGCGAATA 
0181 ACTGCCTGGA GGCGACCAAG GTGCTGAAGT GCTCCAACTG CAGGTATGTG TCCTACTGCC 
0241 ACCGCTCATG CCAGATGCAA GCTTGGGGCC AGCACAAGCA CGAGTGTCCT TTCCTCAAGA 
0301 AGGTGCATCC TCGAGTTGTG CCCGATGCTG CCCGAATGCT CTGCCGACTG ATCCTGCGCC 
0361 TGGAGCACGG CGGNAGACCT GATCCGCGGC TATTACACCG AGCACGGCTC CCGCAAGTTT 
0421 CGCGATCTCA TGTCCCATTA CGCCGAAATC AAGAACGATC CCATGCGACT GGAGCACTTG 
0481 GACTCGCTGC ATGCCGTCCT CA 
 in silico PCR Fragment
0001 CACCGCCACC GTTGGTTCAT CCAGATCCGC AACCACATCC GCAACCGCAT CCGCATGCTC 
0061 ATCCAAATCC AAGAACCTAA AGAATCCGGC GCCGCAAATA AAAAGGGGAC AGCGGATCCT 
0121 CACGGAGAAA CCATTCGCCT TCGTCTTGAA ATCACAGTAC CGCCTGGAGC GGTGCG-ATA 
0181 ACTGCCTGGA GGCGACCAAG GTGCTGAAGT GCTCCAACTG CAGGTATGTG TCCTACTGCC 
0241 ACCGCTCATG CCAGATGCAA GCTTGGGGCC AGCACAAGCA CGAGTGTCCT TTCCTCAAGA 
0301 AGGTGCATCC TCGAGTTGTG CCCGATGCTG CCCGAATGCT CTGCCGACTG ATCCTGCGCC 
0361 TGGAGCACGG CGG-AGACCT GATCCGCGGC TATTACACCG AGCACGGCTC CCGCAAGTTT 
0421 CGCGATCTCA TGTCCCATTA CGCCGAAATC AAGAACGATC CCATGCGACT GGAGCACTTG 
0481 GACTCGCTGC ATGCCGTCCT CA 
 Assemble Data

13761R-3.IR_full       1   CACCGCCACCGTTGGTTCATCCAGATCCGCAACCACATCCGCAACCGCATCCGCATGCTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     1   CACCGCCACCGTTGGTTCATCCAGATCCGCAACCACATCCGCAACCGCATCCGCATGCTC 60


13761R-3.IR_full       61  ATCCAAATCCAAGAACCTAAAGAATCCGGCGCCGCAAATAAAAAGGGGACAGCGGATCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     61  ATCCAAATCCAAGAACCTAAAGAATCCGGCGCCGCAAATAAAAAGGGGACAGCGGATCCT 120


13761R-3.IR_full       121 CACGGAGAAACCATTCGCCTTCGTCTTGAAATCACAGTACCGCCTGGAGCGGTGCGAATA 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
13761R-3.in silico     121 CACGGAGAAACCATTCGCCTTCGTCTTGAAATCACAGTACCGCCTGGAGCGGTGCG-ATA 180


13761R-3.IR_full       181 ACTGCCTGGAGGCGACCAAGGTGCTGAAGTGCTCCAACTGCAGGTATGTGTCCTACTGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     181 ACTGCCTGGAGGCGACCAAGGTGCTGAAGTGCTCCAACTGCAGGTATGTGTCCTACTGCC 240


13761R-3.IR_full       241 ACCGCTCATGCCAGATGCAAGCTTGGGGCCAGCACAAGCACGAGTGTCCTTTCCTCAAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     241 ACCGCTCATGCCAGATGCAAGCTTGGGGCCAGCACAAGCACGAGTGTCCTTTCCTCAAGA 300


13761R-3.IR_full       301 AGGTGCATCCTCGAGTTGTGCCCGATGCTGCCCGAATGCTCTGCCGACTGATCCTGCGCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     301 AGGTGCATCCTCGAGTTGTGCCCGATGCTGCCCGAATGCTCTGCCGACTGATCCTGCGCC 360


13761R-3.IR_full       361 TGGAGCACGGCGGNAGACCTGATCCGCGGCTATTACACCGAGCACGGCTCCCGCAAGTTT 420
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     361 TGGAGCACGGCGG-AGACCTGATCCGCGGCTATTACACCGAGCACGGCTCCCGCAAGTTT 420


13761R-3.IR_full       421 CGCGATCTCATGTCCCATTACGCCGAAATCAAGAACGATCCCATGCGACTGGAGCACTTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13761R-3.in silico     421 CGCGATCTCATGTCCCATTACGCCGAAATCAAGAACGATCCCATGCGACTGGAGCACTTG 480


13761R-3.IR_full       481 GACTCGCTGCATGCCGTCCTCA 502
                           ||||||||||||||||||||||
13761R-3.in silico     481 GACTCGCTGCATGCCGTCCTCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  10  NM_080029.3  CG13761-RB (Bzd), mRNA 
0.62   24  61  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   25  NM_080531.2  CG5481-RA (lea), mRNA 
0   13  NM_169560.1  CG2988-RA (ems), mRNA 
0   13  23  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   13  23  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   NM_078651.2  CG18582-RA (mbt), mRNA 
0   15  NM_167455.1  CG12708-RA (CG12708), mRNA 
0   14  NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   10  28  NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_137177.2  CG11808-RA (CG11808), mRNA 
0   16  NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_136267.3  CG3305-RA (CG3305), mRNA 
0   NM_136367.1  CG30431-RA (CG30431), mRNA 
0   NM_134917.2  CG15406-RA (CG15406), mRNA 
0   NM_078943.1  CG12931-RA (Or45b), mRNA 
0   14  15  NM_206567.1  CG6892-RB, transcript variant B (Ets96B), mRNA 
0   14  15  NM_143029.2  CG6892-RA, transcript variant A (Ets96B), mRNA 
0   12  21  NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   12  14  NM_139364.2  CG1049-RA, transcript variant A (Cct1), mRNA 
0   12  14  NM_167893.1  CG1049-RC, transcript variant C (Cct1), mRNA 
0   12  14  NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   12  14  NM_167894.1  CG1049-RD, transcript variant D (Cct1), mRNA 
0   10  37  NM_167441.2  CG9176-RB, transcript variant B (cngl), mRNA 
0   10  36  NM_078608.3  CG9176-RC, transcript variant C (cngl), mRNA 
0   10  18  NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   34  NM_137146.1  CG12856-RA (CG12856), mRNA 
0   34  NM_080074.2  CG10197-RA (kn), mRNA 
0   24  NM_132787.1  CG15032-RA (CG15032), mRNA 
0   13  NM_133114.2  CG32541-RA (CG32541), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.