National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13745R-3 
 Symbol CG13745  Full Name CG13745 
 CG No CG13745  Old CG No CG13745 
 Synonyms CG13745 
 Accession No (Link to NCBI) NM_136585.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGTGAGAAGGCGCGCTTTG 
 Primer Seq. 3'
aatctagaggtaccTGGCGTGAGGATTGAGGCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGTGAGAA GGCGCGCTTT GATGAGCTGG AACTGCTCAT TCAAAACACT CCAATAGAAA 
0061 AGTTAAAGGA AACCCTTAAA TCCACAATGA CACGCAGCGA GGGCATAACG TATTGGAACT 
0121 ACCTTCTCCG TGGCTTCAAT CCGGAGAGCA AGGATGCGCT AGCCAAGCGA TTCGAATGTG 
0181 TCCGCAGCTT CATGGACGGA CTGAGCAGCA CGGAACTGAG CTACAAACAG ACTTTCGATC 
0241 TGATCACGCG CCTGTCGCAG GACCTGGCCA CCTTTCCGTC CGAGCAGCTG GCCTGGATCG 
0301 TGGAGCACTG CATGGACGGG ATCCGACAAG GAGACGCCAA GTGCGTCGGC TGGAAGGATT 
0361 TGTTGCCGGV CGCGCTGTCG CTGCTTTTGG CCAGACCGCG GTTTCTTCTG AACGGCATAT 
0421 CCATAGATGG AATGGAGTTC AGGGACaCTA CCGTAAGGAG CATTGCCACC ATGCAATGGC 
0481 CAGCCTCAAT CCTCACGCCA  
 in silico PCR Fragment
0001 TGGGTGAGAA GGCGCGCTTT GATGAGCTGG AACTGCTCAT TCAAAACACT CCAATAGAAA 
0061 AGTTAAAGGA AACCCTTAAA TCCACAATGA CACGCAGCGA GGGCATAACG TATTGGAACT 
0121 ACCTTCTCCG TGGCTTCAAT CCGGAGAGCA AGGATGCGCT AGCCAAGCGA TTCGAATGTG 
0181 TCCGCAGCTT CATGGACGGA CTGAGCAGCA CGGAACTGAG CTACAAACAG ACTTTCGATC 
0241 TGATCACGCG CCTGTCGCAG GACCTGGCCA CCTTTCCGTC CGAGCAGCTG GCCTGGATCG 
0301 TGGAGCACTG CATGGACGGG ATCCGACAAG GAGACGCCAA GTGCGTCGGC TGGAAGGATT 
0361 TGCTGCCGGA CGCGCTGTCG CTGCTTTTGG CCAGACCGCG GTTTCTTCTG AACGGCATAT 
0421 CCATAGATGG AATGGAGTTC AGGGACACTA CCGTAAGGAG CATTGCCACC ATGCAATGGC 
0481 CAGCCTCAAT CCTCACGCCA  
 Assemble Data

13745R-3.IR_full       1   TGGGTGAGAAGGCGCGCTTTGATGAGCTGGAACTGCTCATTCAAAACACTCCAATAGAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     1   TGGGTGAGAAGGCGCGCTTTGATGAGCTGGAACTGCTCATTCAAAACACTCCAATAGAAA 60


13745R-3.IR_full       61  AGTTAAAGGAAACCCTTAAATCCACAATGACACGCAGCGAGGGCATAACGTATTGGAACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     61  AGTTAAAGGAAACCCTTAAATCCACAATGACACGCAGCGAGGGCATAACGTATTGGAACT 120


13745R-3.IR_full       121 ACCTTCTCCGTGGCTTCAATCCGGAGAGCAAGGATGCGCTAGCCAAGCGATTCGAATGTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     121 ACCTTCTCCGTGGCTTCAATCCGGAGAGCAAGGATGCGCTAGCCAAGCGATTCGAATGTG 180


13745R-3.IR_full       181 TCCGCAGCTTCATGGACGGACTGAGCAGCACGGAACTGAGCTACAAACAGACTTTCGATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     181 TCCGCAGCTTCATGGACGGACTGAGCAGCACGGAACTGAGCTACAAACAGACTTTCGATC 240


13745R-3.IR_full       241 TGATCACGCGCCTGTCGCAGGACCTGGCCACCTTTCCGTCCGAGCAGCTGGCCTGGATCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     241 TGATCACGCGCCTGTCGCAGGACCTGGCCACCTTTCCGTCCGAGCAGCTGGCCTGGATCG 300


13745R-3.IR_full       301 TGGAGCACTGCATGGACGGGATCCGACAAGGAGACGCCAAGTGCGTCGGCTGGAAGGATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     301 TGGAGCACTGCATGGACGGGATCCGACAAGGAGACGCCAAGTGCGTCGGCTGGAAGGATT 360


13745R-3.IR_full       361 TGTTGCCGGVCGCGCTGTCGCTGCTTTTGGCCAGACCGCGGTTTCTTCTGAACGGCATAT 420
                           || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     361 TGCTGCCGGACGCGCTGTCGCTGCTTTTGGCCAGACCGCGGTTTCTTCTGAACGGCATAT 420


13745R-3.IR_full       421 CCATAGATGGAATGGAGTTCAGGGACACTACCGTAAGGAGCATTGCCACCATGCAATGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13745R-3.in silico     421 CCATAGATGGAATGGAGTTCAGGGACACTACCGTAAGGAGCATTGCCACCATGCAATGGC 480


13745R-3.IR_full       481 CAGCCTCAATCCTCACGCCA 500
                           ||||||||||||||||||||
13745R-3.in silico     481 CAGCCTCAATCCTCACGCCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.