National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13745R-2 
 Symbol CG13745  Full Name CG13745 
 CG No CG13745  Old CG No CG13745 
 Synonyms CG13745 
 Accession No (Link to NCBI) NM_136585.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGTGAGAAGGCGCGCTTTGATGAGCTGGAACTGCTCATTCAAAACACTCCAATAGAAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGTTAAAGGAAACCCTTAAATCCACAATGACACGCAGCGAGGGCATAACGTATTGGAACT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCTTCTCCGTGGCTTCAATCCGGAGAGCAAGGATGCGCTAGCCAAGCGATTCGAATGTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCGCAGCTTCATGGACGGACTGAGCAGCACGGAACTGAGCTACAAACAGACTTTCGATC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGATCACGCGCCTGTCGCAGGACCTGGCCACCTTTCCGTCCGAGCAGCTGGCCTGGATCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGAGCACTGCATGGACGGGATCCGACAAGGAGACGCCAAGTGCGTCGGCTGGAAGGATT 360

                           || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCTGCCGGACGCGCTGTCGCTGCTTTTGGCCAGACCGCGGTTTCTTCTGAACGGCATAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCATAGATGGAATGGAGTTCAGGGACACTACCGTAAGGAGCATTGCCACCATGCAATGGC 480

13745R-2.IR_full       481 CAGCCTCAATCCTCACGCCA 500
                           |||||||||||||||||||| silico     481 CAGCCTCAATCCTCACGCCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 
0   NM_167059.1  CG5905-RB, transcript variant B (Nep1), mRNA 
0   NM_137191.1  CG18625-RA (CG18625), mRNA 
0   NM_142141.2  CG3631-RA, transcript variant A (CG3631), mRNA 
0   NM_169605.1  CG3631-RB, transcript variant B (CG3631), mRNA 
0   NM_206490.1  CG3631-RC, transcript variant C (CG3631), mRNA 
0   NM_169774.1  CG31249-RA (CG31249), mRNA 
0   NM_132790.1  CG9123-RA (CG9123), mRNA 
0   NM_078720.2  CG11840-RA (Spp), mRNA 
0   NM_141468.1  CG1287-RA (CG1287), mRNA 
0   NM_206204.1  CG30194-RD, transcript variant D (CG30194), mRNA 
0   NM_206203.1  CG30194-RC, transcript variant C (CG30194), mRNA 
0   NM_137905.2  CG30194-RB, transcript variant B (CG30194), mRNA 
0   NM_168055.1  CG14994-RB, transcript variant B (Gad1), mRNA 
0   NM_168056.1  CG14994-RC, transcript variant C (Gad1), mRNA 
0   NM_079190.2  CG14994-RA, transcript variant A (Gad1), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   NM_135950.2  CG5888-RA (CG5888), mRNA 
0   NM_205892.1  CG3539-RC, transcript variant C (Slh), mRNA 
0   NM_205891.1  CG3539-RD, transcript variant D (Slh), mRNA 
0   NM_132678.2  CG2691-RA (CG2691), mRNA 
0   NM_137997.2  CG5597-RA (CG5597), mRNA 
0   NM_132545.2  CG1806-RA (CG1806), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_132508.2  CG1703-RA (CG1703), mRNA 
0   18  47  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   17  NM_140271.1  CG17826-RA (CG17826), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.