National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13722R-1 
 Symbol CG13722  Full Name CG13722 
 CG No CG13722  Old CG No CG13722 
 Synonyms CG13722 
 Accession No (Link to NCBI) NM_139654.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACCTTTTCCCCAGCCAAAAC 
 Primer Seq. 3'
aatctagaggtaccCAGATACTTTTGCGGAGGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACCTTTTCC CCAGCCAAAA CAAGGATACG ATTACCCCAA GCCGGCAGTT CCGTTCCCAC 
0061 CACCAGCTGT TCCAACACAA AAGTACTTGC CACCTGTAAC CACAACTCAA GCGCCACCTC 
0121 CTCAAGTTAA ACAGGGATAC GACTATCCAA AGCCTGCCAT TCCATTCCCA CCGCCTACTG 
0181 CTCCGCCACA AAAGTATCTT CCCCCGGTGA CCACCACTCC TGCTCCACCT CCACCACCAC 
0241 CGCCGACTAA GAAGTACCTG CCACCCCCTC AGGTTAAGCA GGGTTACGAT TATCCTAAGC 
0301 CAGCAATTCC ATTCCCACCA CCCACCAACC CACCACAGAA ATACCTGCCT CCCGTTGTGC 
0361 CAACCAGCCC TCCTGTGCCA AAATACGTTN CCCCACCTAC ACCTACCTAC ATTCCACCAC 
0421 CACCAAAGAA GCAAGGATAT GACTATCCCA AGCCCGCCAT TCCATTCCCA CCACCCACTG 
0481 CTCCTCCGCA AAAGTATCTG  
 in silico PCR Fragment
0001 TACCTTTTCC CCAGCCAAAA CAAGGATACG ATTACCCCAA GCCGGCAGTT CCGTTCCCAC 
0061 CACCAGCTGT TCCAACACAA AAGTACTTGC CACCTGTAAC CACAACTCAA GCGCCACCTC 
0121 CTCAAGTTAA ACAGGGATAC GACTATCCAA AGCCTGCCAT TCCATTCCCA CCGCCTACTG 
0181 CTCCGCCACA AAAGTATCTT CCGCCGGTGA CCACCACTCC TGCTCCACCT CCACCACCAC 
0241 CGCCGACTAA GAAGTACCTG CCACCCCCTC AGGTTAAGCA GGGTTACGAT TATCCTAAGC 
0301 CAGCAATTCC ATTCCCACCA CCCACCAACC CACCACAGAA ATACCTGCCT CCCGTTGTGC 
0361 CAACCAGCCC TCCTGTGCCA AAATACGTTC CCCCACCTAC ACCTACCTAC ATTCCACCAC 
0421 CACCAAAGAA GCAAGGATAT GACTATCCCA AGCCCGCCAT TCCATTCCCA CCACCCACTG 
0481 CTCCTCCGCA AAAGTATCTG  
 Assemble Data

13722R-1.IR_full       1   TACCTTTTCCCCAGCCAAAACAAGGATACGATTACCCCAAGCCGGCAGTTCCGTTCCCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     1   TACCTTTTCCCCAGCCAAAACAAGGATACGATTACCCCAAGCCGGCAGTTCCGTTCCCAC 60


13722R-1.IR_full       61  CACCAGCTGTTCCAACACAAAAGTACTTGCCACCTGTAACCACAACTCAAGCGCCACCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     61  CACCAGCTGTTCCAACACAAAAGTACTTGCCACCTGTAACCACAACTCAAGCGCCACCTC 120


13722R-1.IR_full       121 CTCAAGTTAAACAGGGATACGACTATCCAAAGCCTGCCATTCCATTCCCACCGCCTACTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     121 CTCAAGTTAAACAGGGATACGACTATCCAAAGCCTGCCATTCCATTCCCACCGCCTACTG 180


13722R-1.IR_full       181 CTCCGCCACAAAAGTATCTTCCCCCGGTGACCACCACTCCTGCTCCACCTCCACCACCAC 240
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
13722R-1.in silico     181 CTCCGCCACAAAAGTATCTTCCGCCGGTGACCACCACTCCTGCTCCACCTCCACCACCAC 240


13722R-1.IR_full       241 CGCCGACTAAGAAGTACCTGCCACCCCCTCAGGTTAAGCAGGGTTACGATTATCCTAAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     241 CGCCGACTAAGAAGTACCTGCCACCCCCTCAGGTTAAGCAGGGTTACGATTATCCTAAGC 300


13722R-1.IR_full       301 CAGCAATTCCATTCCCACCACCCACCAACCCACCACAGAAATACCTGCCTCCCGTTGTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     301 CAGCAATTCCATTCCCACCACCCACCAACCCACCACAGAAATACCTGCCTCCCGTTGTGC 360


13722R-1.IR_full       361 CAACCAGCCCTCCTGTGCCAAAATACGTTNCCCCACCTACACCTACCTACATTCCACCAC 420
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
13722R-1.in silico     361 CAACCAGCCCTCCTGTGCCAAAATACGTTCCCCCACCTACACCTACCTACATTCCACCAC 420


13722R-1.IR_full       421 CACCAAAGAAGCAAGGATATGACTATCCCAAGCCCGCCATTCCATTCCCACCACCCACTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13722R-1.in silico     421 CACCAAAGAAGCAAGGATATGACTATCCCAAGCCCGCCATTCCATTCCCACCACCCACTG 480


13722R-1.IR_full       481 CTCCTCCGCAAAAGTATCTG 500
                           ||||||||||||||||||||
13722R-1.in silico     481 CTCCTCCGCAAAAGTATCTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
110.99  535  168  490  737  NM_139654.1  CG13722-RA (CG13722), mRNA 
0.62   11  NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0.62   11  NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0.41   39  129  NM_168087.1  CG32241-RA (CG32241), mRNA 
0.2   11  NM_167636.1  CG32543-RA (CG32543), mRNA 
0   11  44  NM_136925.1  CG30042-RA (CG30042), mRNA 
0   19  45  NM_133104.2  CG7282-RA (CG7282), mRNA 
0   25  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   16  78  NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   16  78  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0   31  NM_143635.1  CG2150-RA (CG2150), mRNA 
0   20  NM_132676.2  CG12175-RB (tth), mRNA 
0   16  38  NM_132661.1  CG12726-RA (CG12726), mRNA 
0   13  26  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   22  NM_139585.2  CG10853-RA (CG10853), mRNA 
0   14  NM_206772.1  CG5172-RB, transcript variant B (CG5172), mRNA 
0   NM_135458.3  CG3858-RA, transcript variant A (gcm2), mRNA 
0   NM_205947.1  CG3858-RB, transcript variant B (gcm2), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   24  28  NM_132386.2  CG2961-RA (Ipod), mRNA 
0   21  38  NM_166220.1  CG30458-RA (CG30458), mRNA 
0   16  79  NM_142330.1  CG5225-RA (CG5225), mRNA 
0   14  25  NM_137510.2  CG30122-RB (CG30122), mRNA 
0   14  22  NM_078601.2  CG9533-RA (rut), mRNA 
0   14  15  NM_058161.3  CG5595-RA (Sce), mRNA 
0   12  27  NM_057414.3  CG1389-RA (tor), mRNA 
0   25  NM_132867.1  CG9170-RA, transcript variant A (CG9170), mRNA 
0   25  NM_206753.1  CG9170-RB, transcript variant B (CG9170), mRNA 
0   33  NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   33  NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.