National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13698R-3 
 Symbol CG13698  Full Name CG13698 
 CG No CG13698  Old CG No CG13698 
 Synonyms CG13698 
 Accession No (Link to NCBI) NM_140770.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGGCAGCTCAGCTGTGCTGG 
 Primer Seq. 3'
aatctagaggtaccGGTCACGGTGGTGCTCATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGGCAGCTC AGCTGTGCTG GGCATCTTCT GCATTCTGTC GGTCATTCAA CACGCGATGA 
0061 TCTCATCCAG GGAAAAGGTG GTTATGCCCT ACACAACTCT AGTGATAGTG AAGTTAATGT 
0121 TGGCATTGCT GGGAGGTGTA CTGGCCATTA TAGCGACGGT TTTGTTTGCT CTGCAAATTG 
0181 ATGAGCAGGA NGCGCNTATG GCTTTCAAGA TATCGCGGGG CATTTCCTTC TATATACAGA 
0241 TTGTGGCTAT TGTTTTGACA ATTGCTCTGT TCGTGGCCGC CCTGTACGAT GTGATCTACT 
0301 CGCGCAGTCN CAGGCGGAGA TCCCACAATG GCGCTGGATG TGTCATCTCC GGGCAGTGCC 
0361 ANTACGTTCA ATAATCCGGG TTTCAAGGAG CCGCGCAGTC GCAACGGCGT TTCGGTGACG 
0421 GACGCATCCG GTAAGCCCTA CAGCGGAATC CGGAATGGAG CGGGAACGGC GGGCAGCGTG 
0481 GCCTCCATGA GCACNCACCG TGACc 
 in silico PCR Fragment
0001 TTGGCAGCTC AGCTGTGCTG GGCATCTTCT GCATTCTGTC GGTCATTCAA CACGCGATGA 
0061 TCTCATCCAG GGAGAAGGTG GTTATGCCCT ACACAACTCT AGTGATAGTG AAGTTAATGT 
0121 TGGCATTGCT GGGAGGTGTA CTGGCCATCA TAGCGACGGT TTTGTTTGCT CTGCAAATTG 
0181 ATGAGCAGGA -GCGC-TATG GC-TTCAAGA TATCGCGGGG CATTTCCTTC TATATACAGA 
0241 TTGTGGCTAT TGTTTTGACA ATTGCTCTGT TCGTGGCCGC CCTGTACGAT GTGATCTACT 
0301 CGCGCAGTC- CAGGCGGAGA TCCCACAATG GCGCTGGATG TGTCATCTCC GGGCAGTGCC 
0361 ACTACGTTCA ATAATCCTGG TTTCAAGGAG CCTCGCAGTC GCAACGGCGT TTCGGTGACG 
0421 GACGCATCCG GTAAGCCCTA CAGCGGAATC CGGAATGGAG CGGGAACGGC GGGCAGCGTG 
0481 GCCTCCATGA GCAC-CACCG TGACC 
 Assemble Data

13698R-3.IR_full       1   TTGGCAGCTCAGCTGTGCTGGGCATCTTCTGCATTCTGTCGGTCATTCAACACGCGATGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13698R-3.in silico     1   TTGGCAGCTCAGCTGTGCTGGGCATCTTCTGCATTCTGTCGGTCATTCAACACGCGATGA 60


13698R-3.IR_full       61  TCTCATCCAGGGAAAAGGTGGTTATGCCCTACACAACTCTAGTGATAGTGAAGTTAATGT 120
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
13698R-3.in silico     61  TCTCATCCAGGGAGAAGGTGGTTATGCCCTACACAACTCTAGTGATAGTGAAGTTAATGT 120


13698R-3.IR_full       121 TGGCATTGCTGGGAGGTGTACTGGCCATTATAGCGACGGTTTTGTTTGCTCTGCAAATTG 180
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
13698R-3.in silico     121 TGGCATTGCTGGGAGGTGTACTGGCCATCATAGCGACGGTTTTGTTTGCTCTGCAAATTG 180


13698R-3.IR_full       181 ATGAGCAGGANGCGCNTATGGCTTTCAAGATATCGCGGGGCATTTCCTTCTATATACAGA 240
                           |||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||
13698R-3.in silico     181 ATGAGCAGGA-GCGC-TATGGC-TTCAAGATATCGCGGGGCATTTCCTTCTATATACAGA 240


13698R-3.IR_full       241 TTGTGGCTATTGTTTTGACAATTGCTCTGTTCGTGGCCGCCCTGTACGATGTGATCTACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13698R-3.in silico     241 TTGTGGCTATTGTTTTGACAATTGCTCTGTTCGTGGCCGCCCTGTACGATGTGATCTACT 300


13698R-3.IR_full       301 CGCGCAGTCNCAGGCGGAGATCCCACAATGGCGCTGGATGTGTCATCTCCGGGCAGTGCC 360
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13698R-3.in silico     301 CGCGCAGTC-CAGGCGGAGATCCCACAATGGCGCTGGATGTGTCATCTCCGGGCAGTGCC 360


13698R-3.IR_full       361 ANTACGTTCAATAATCCGGGTTTCAAGGAGCCGCGCAGTCGCAACGGCGTTTCGGTGACG 420
                           | ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
13698R-3.in silico     361 ACTACGTTCAATAATCCTGGTTTCAAGGAGCCTCGCAGTCGCAACGGCGTTTCGGTGACG 420


13698R-3.IR_full       421 GACGCATCCGGTAAGCCCTACAGCGGAATCCGGAATGGAGCGGGAACGGCGGGCAGCGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13698R-3.in silico     421 GACGCATCCGGTAAGCCCTACAGCGGAATCCGGAATGGAGCGGGAACGGCGGGCAGCGTG 480


13698R-3.IR_full       481 GCCTCCATGAGCACNCACCGTGACC 505
                           |||||||||||||| ||||||||||
13698R-3.in silico     481 GCCTCCATGAGCAC-CACCGTGACC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140770.2  CG13698-RB (CG13698), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_132425.3  CG15211-RA (CG15211), mRNA 
0   NM_136007.2  CG7094-RA (CG7094), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_137785.1  CG9308-RA (CG9308), mRNA 
0   NM_132607.1  CG4661-RA (CG4661), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   10  NM_137175.2  CG8092-RA, transcript variant A (CG8092), mRNA 
0   10  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166081.1  CG8092-RB, transcript variant B (CG8092), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_141260.2  CG2604-RA, transcript variant A (CG2604), mRNA 
0   NM_169029.1  CG2604-RB, transcript variant B (CG2604), mRNA 
0   NM_169030.1  CG2604-RC, transcript variant C (CG2604), mRNA 
0   NM_132757.1  CG12398-RA (CG12398), mRNA 
0   NM_079816.3  CG1867-RA (Or98b), mRNA 
0   NM_206144.1  CG15609-RB, transcript variant B (CG15609), mRNA 
0   NM_137335.2  CG15609-RA, transcript variant A (CG15609), mRNA 
0   NM_206143.1  CG15609-RC, transcript variant C (CG15609), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_143401.1  CG1957-RA, transcript variant A (CG1957), mRNA 
0   NM_170385.1  CG1957-RB, transcript variant B (CG1957), mRNA 
0   NM_142334.1  CG3995-RA (CG3995), mRNA 
0   NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.