National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13695R-3 
 Symbol gk  Full Name geko 
 CG No CG13695  Old CG No CG13695 
 Synonyms CT33153, Geko, CG13696, CG13695, BcDNA:RE30284, gk, geko 
 Accession No (Link to NCBI) NM_080241.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGTTGTCGCCTCATGATCTTCGTTATCGTCTCGCTGCTCCTTGTGGGCGATCTTTTTGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TACGGCGGCGGCATGAAGTCCAACCACCCCAATCCGCACTCGGTAAGATCGGCGCGGGGC 120

                           ||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||| silico     121 GCGGT-GCCGGGTGGTGCCCCAACGGGTCCGGCGGCTGCAGCGGCCAGC-AAGTTCCAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCAAAAATGCCGAAATCGACATAACTGAAGAGCACGATTTCAATGAACTCTCAGCAGCAG 240

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     241 CTCAATCCCTCAAGCCTGGAATGGC-AGTGGTTACTGGGGCTAGTCTGAAGACCAAGTCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAACTCACGGACGCCATCAAGGAATCATGTCTCCCCAAGATGCTCTGCGAACTGGCCTCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAGGCGGATTACCAACTCAGCGAAAAGGAGCGGGAACTGCTAAGACTGATCAGATCTCCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAATGCCCTGGATGATGAACATGCCGCCGAGCAAATGGTATTTTGCGGCCCACATGGGC 480

13695R-3.IR_full       481 GAACTCATGCGTCACACTGGCGA 503
                           ||||||||||||||||||||||| silico     481 GAACTCATGCGTCACACTGGCGA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080241.2  CG13695-RB (gk), mRNA 
0   NM_137100.2  CG8503-RA (CG8503), mRNA 
0   NM_135751.2  CG5075-RA (CG5075), mRNA 
0   11  NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   11  NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   NM_132343.2  CG3002-RB (Gga), mRNA 
0   NM_142299.1  CG11769-RA (CG11769), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   10  NM_078700.2  CG1849-RA (run), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   12  NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_135898.2  CG15267-RA (CG15267), mRNA 
0   NM_205893.1  CG31690-RA, transcript variant A (CG31690), mRNA 
0   NM_164492.1  CG31690-RB, transcript variant B (CG31690), mRNA 
0   NM_142930.2  CG10198-RA (Nup98), mRNA 
0   NM_057601.2  CG2851-RA (Gsc), mRNA 
0   NM_139847.2  CG8601-RA, transcript variant A (mus312), mRNA 
0   NM_001043124.1  CG8601-RC, transcript variant C (mus312), mRNA 
0   NM_168200.1  CG8601-RB, transcript variant B (mus312), mRNA 
0   NM_058144.2  CG11420-RA (png), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   11  NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   11  NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   NM_134477.1  CG14204-RA (CG14204), mRNA 
0   16  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   16  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_143496.3  CG15523-RA (CG15523), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.