National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13695R-2 
 Symbol gk  Full Name geko 
 CG No CG13695  Old CG No CG13695 
 Synonyms CT33153, Geko, CG13696, CG13695, BcDNA:RE30284, gk, geko 
 Accession No (Link to NCBI) NM_080241.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTTGTCGCCTCATGATCTTC 
 Primer Seq. 3'
aatctagaggtaccTCGCCAGTGTGACGCATGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTTGTCGCC TCATGATCTT CGTTATCGTC TCGCTGCTCC TTGTGGGCGA TCTTTTTGGA 
0061 TACGGCGGCG GCATGAAGTC CAACCACCCC AATCCGCACT CGGTAAGATC GGCGCGGGGC 
0121 GCGGTNGCCG GGAGGTGCCC CAACGGGTCC GGCGGCTGCA GCGGCCAGCN AAGTTCCAGA 
0181 CCAAAAATGC CGAAATCGAC ATAACTGAAG AGCACGATTT CAATGAACTC TCAGCAGCAG 
0241 CTCAATCCCT CAAGCCTGGA ATGGCNAGTG GTTACTGGGG CTAGTCTGAA GACCAAGTCC 
0301 CAACTCACGG ACGCCATCAA GGAATCATGT CTCCCCAAGA TGCTCTGCGA ACTGGCCTCC 
0361 AAGGCGGATT ACCAACTCAG CGAAAAGGAG CGGGAACTGC TAAGACTGAT CAGATCTCCA 
0421 ACAATGCCCT GGATGATGAA CATGCCGCCG AGCAAATGGT ATTTTGCGGC CCACATGGGC 
0481 GAACTCATGC GTCACACTGG CGA 
 in silico PCR Fragment
0001 CGTTGTCGCC TCATGATCTT CGTTATCGTC TCGCTGCTCC TTGTGGGCGA TCTTTTTGGA 
0061 TACGGCGGCG GCATGAAGTC CAACCACCCC AATCCGCACT CGGTAAGATC GGCGCGGGGC 
0121 GCGGT-GCCG GGTGGTGCCC CAACGGGTCC GGCGGCTGCA GCGGCCAGC- AAGTTCCAGA 
0181 CCAAAAATGC CGAAATCGAC ATAACTGAAG AGCACGATTT CAATGAACTC TCAGCAGCAG 
0241 CTCAATCCCT CAAGCCTGGA ATGGC-AGTG GTTACTGGGG CTAGTCTGAA GACCAAGTCC 
0301 CAACTCACGG ACGCCATCAA GGAATCATGT CTCCCCAAGA TGCTCTGCGA ACTGGCCTCC 
0361 AAGGCGGATT ACCAACTCAG CGAAAAGGAG CGGGAACTGC TAAGACTGAT CAGATCTCCA 
0421 ACAATGCCCT GGATGATGAA CATGCCGCCG AGCAAATGGT ATTTTGCGGC CCACATGGGC 
0481 GAACTCATGC GTCACACTGG CGA 
 Assemble Data

13695R-2.IR_full       1   CGTTGTCGCCTCATGATCTTCGTTATCGTCTCGCTGCTCCTTGTGGGCGATCTTTTTGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     1   CGTTGTCGCCTCATGATCTTCGTTATCGTCTCGCTGCTCCTTGTGGGCGATCTTTTTGGA 60


13695R-2.IR_full       61  TACGGCGGCGGCATGAAGTCCAACCACCCCAATCCGCACTCGGTAAGATCGGCGCGGGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     61  TACGGCGGCGGCATGAAGTCCAACCACCCCAATCCGCACTCGGTAAGATCGGCGCGGGGC 120


13695R-2.IR_full       121 GCGGTNGCCGGGAGGTGCCCCAACGGGTCCGGCGGCTGCAGCGGCCAGCNAAGTTCCAGA 180
                           ||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||
13695R-2.in silico     121 GCGGT-GCCGGGTGGTGCCCCAACGGGTCCGGCGGCTGCAGCGGCCAGC-AAGTTCCAGA 180


13695R-2.IR_full       181 CCAAAAATGCCGAAATCGACATAACTGAAGAGCACGATTTCAATGAACTCTCAGCAGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     181 CCAAAAATGCCGAAATCGACATAACTGAAGAGCACGATTTCAATGAACTCTCAGCAGCAG 240


13695R-2.IR_full       241 CTCAATCCCTCAAGCCTGGAATGGCNAGTGGTTACTGGGGCTAGTCTGAAGACCAAGTCC 300
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
13695R-2.in silico     241 CTCAATCCCTCAAGCCTGGAATGGC-AGTGGTTACTGGGGCTAGTCTGAAGACCAAGTCC 300


13695R-2.IR_full       301 CAACTCACGGACGCCATCAAGGAATCATGTCTCCCCAAGATGCTCTGCGAACTGGCCTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     301 CAACTCACGGACGCCATCAAGGAATCATGTCTCCCCAAGATGCTCTGCGAACTGGCCTCC 360


13695R-2.IR_full       361 AAGGCGGATTACCAACTCAGCGAAAAGGAGCGGGAACTGCTAAGACTGATCAGATCTCCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     361 AAGGCGGATTACCAACTCAGCGAAAAGGAGCGGGAACTGCTAAGACTGATCAGATCTCCA 420


13695R-2.IR_full       421 ACAATGCCCTGGATGATGAACATGCCGCCGAGCAAATGGTATTTTGCGGCCCACATGGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13695R-2.in silico     421 ACAATGCCCTGGATGATGAACATGCCGCCGAGCAAATGGTATTTTGCGGCCCACATGGGC 480


13695R-2.IR_full       481 GAACTCATGCGTCACACTGGCGA 503
                           |||||||||||||||||||||||
13695R-2.in silico     481 GAACTCATGCGTCACACTGGCGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080241.2  CG13695-RB (gk), mRNA 
0   NM_137100.2  CG8503-RA (CG8503), mRNA 
0   NM_135751.2  CG5075-RA (CG5075), mRNA 
0   11  NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   11  NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   NM_132343.2  CG3002-RB (Gga), mRNA 
0   NM_142299.1  CG11769-RA (CG11769), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   10  NM_078700.2  CG1849-RA (run), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   12  NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_135898.2  CG15267-RA (CG15267), mRNA 
0   NM_205893.1  CG31690-RA, transcript variant A (CG31690), mRNA 
0   NM_164492.1  CG31690-RB, transcript variant B (CG31690), mRNA 
0   NM_142930.2  CG10198-RA (Nup98), mRNA 
0   NM_057601.2  CG2851-RA (Gsc), mRNA 
0   NM_139847.2  CG8601-RA, transcript variant A (mus312), mRNA 
0   NM_001043124.1  CG8601-RC, transcript variant C (mus312), mRNA 
0   NM_168200.1  CG8601-RB, transcript variant B (mus312), mRNA 
0   NM_058144.2  CG11420-RA (png), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   11  NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   11  NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   NM_134477.1  CG14204-RA (CG14204), mRNA 
0   16  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   16  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_143496.3  CG15523-RA (CG15523), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.