National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13681R-1 
 Symbol CG13681  Full Name CG13681 
 CG No CG13681  Old CG No CG13681 
 Synonyms CG13681 
 Accession No (Link to NCBI) NM_139913.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAACTCACCACAGCTGGCG 
 Primer Seq. 3'
aatctagaggtaccATCACAGGCGACATGTCCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAACTCAC CACAGCTGGC GCCCACCACT GCGCAATCTC ACCACGCTGA GAGCGCTGAC 
0061 AAAACAGCGC CGCCTGGAAA TAAATATGCG CCTGGAAGAA GGCTAGCTGC GCGGCAAACT 
0121 CTTCGATTGG CAATACCGAA GGCGCAACCC GGTGAACCAC TGAATCACCC AACGAGTGTC 
0181 GGCCTCTTTC GTCCCTCACC GTCGCAACTG CCACCGGCAC CGATTTTGAA GCGCGTTCCA 
0241 GCGGTCAGCG GCGGGTGCAG TGGAATACCG AAGTCCGCCT CGCCACTGGA ATCGCACCAC 
0301 CTGCCCAATG TCACGCCCAC CAACGCGCAC ACCCGTTTGG GCTATGGCAT GCAGGGCGCG 
0361 GGGGGTGGCA GTGGCTGTTC CAGTGCCTCA TCAGCATCCA ATTTTCTGGG CGTGCGCAAG 
0421 CCCAGCCTGA CCTTGAACTC ATCGGATATC CGGAACAACA ACGATCTGTT CGCCTTCCCC 
0481 AAGGACATGT CGCCTGTGAT  
 in silico PCR Fragment
0001 ATGAACTCAC CACAGCTGGC GCCCACCACT GCGCAATCTC ACCACGCTGA GAGCGCTGAC 
0061 AAAACAGCGC CGCCTGGAAA TAAATATGCG CCTGGAAGAA GGCTAGCTGC GCGGCAAACT 
0121 CTTCGATTGG CAATACCGAA GGCGCAACCC GGTGACCCAC TGAATCACCC AACGAGTGTC 
0181 GGCCTCTTTC GTCCCTCACC ATCGCAACTG CCACCGGCAC CGATTTTGAA GCGCGTTCCA 
0241 GCGGTCAGCG GCGGGTGCAG TGGAATACCG AAGTCCGCCT CGCCACTGGA ATCGCACCAC 
0301 CTGCCCAATG TCACGCCCAC CAACGCGCAC ACCCGTTTGG GCTATGGCAT GCAGGGCGCG 
0361 GGGGGAGGCA GTAGCTGTTC CAGTGCCTCA TCAGCATCCA ATTTTCTGGG CGTGCGCAAG 
0421 CCCAGCCTGA CCTTGAACTC ATCGGATATC CGGAACAACA ACGATCTGTT CGCCTTCCCC 
0481 AAGGACATGT CGCCTGTGAT  
 Assemble Data

13681R-1.IR_full       1   ATGAACTCACCACAGCTGGCGCCCACCACTGCGCAATCTCACCACGCTGAGAGCGCTGAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     1   ATGAACTCACCACAGCTGGCGCCCACCACTGCGCAATCTCACCACGCTGAGAGCGCTGAC 60


13681R-1.IR_full       61  AAAACAGCGCCGCCTGGAAATAAATATGCGCCTGGAAGAAGGCTAGCTGCGCGGCAAACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     61  AAAACAGCGCCGCCTGGAAATAAATATGCGCCTGGAAGAAGGCTAGCTGCGCGGCAAACT 120


13681R-1.IR_full       121 CTTCGATTGGCAATACCGAAGGCGCAACCCGGTGAACCACTGAATCACCCAACGAGTGTC 180
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
13681R-1.in silico     121 CTTCGATTGGCAATACCGAAGGCGCAACCCGGTGACCCACTGAATCACCCAACGAGTGTC 180


13681R-1.IR_full       181 GGCCTCTTTCGTCCCTCACCGTCGCAACTGCCACCGGCACCGATTTTGAAGCGCGTTCCA 240
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     181 GGCCTCTTTCGTCCCTCACCATCGCAACTGCCACCGGCACCGATTTTGAAGCGCGTTCCA 240


13681R-1.IR_full       241 GCGGTCAGCGGCGGGTGCAGTGGAATACCGAAGTCCGCCTCGCCACTGGAATCGCACCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     241 GCGGTCAGCGGCGGGTGCAGTGGAATACCGAAGTCCGCCTCGCCACTGGAATCGCACCAC 300


13681R-1.IR_full       301 CTGCCCAATGTCACGCCCACCAACGCGCACACCCGTTTGGGCTATGGCATGCAGGGCGCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     301 CTGCCCAATGTCACGCCCACCAACGCGCACACCCGTTTGGGCTATGGCATGCAGGGCGCG 360


13681R-1.IR_full       361 GGGGGTGGCAGTGGCTGTTCCAGTGCCTCATCAGCATCCAATTTTCTGGGCGTGCGCAAG 420
                           ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     361 GGGGGAGGCAGTAGCTGTTCCAGTGCCTCATCAGCATCCAATTTTCTGGGCGTGCGCAAG 420


13681R-1.IR_full       421 CCCAGCCTGACCTTGAACTCATCGGATATCCGGAACAACAACGATCTGTTCGCCTTCCCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13681R-1.in silico     421 CCCAGCCTGACCTTGAACTCATCGGATATCCGGAACAACAACGATCTGTTCGCCTTCCCC 480


13681R-1.IR_full       481 AAGGACATGTCGCCTGTGAT 500
                           ||||||||||||||||||||
13681R-1.in silico     481 AAGGACATGTCGCCTGTGAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139913.1  CG13681-RA (CG13681), mRNA 
0.2   NM_136091.3  CG10473-RA, transcript variant A (CG10473), mRNA 
0.2   NM_165273.1  CG10473-RB, transcript variant B (CG10473), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   13  NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   13  NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   13  NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   13  NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_057882.3  CG1609-RA (Gcn2), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_131951.1  CG15473-RA (CG15473), mRNA 
0   NM_137806.2  CG5465-RA (MED16), mRNA 
0   NM_078871.4  CG10305-RB, transcript variant B (RpS26), mRNA 
0   NM_165252.1  CG10305-RA, transcript variant A (RpS26), mRNA 
0   NM_165253.1  CG10305-RC, transcript variant C (RpS26), mRNA 
0   NM_143704.1  CG2916-RB, transcript variant B (Sep5), mRNA 
0   NM_165578.1  CG2916-RA, transcript variant A (Sep5), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_142367.1  CG5866-RA (CG5866), mRNA 
0   NM_079159.2  CG1004-RA (rho), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_001038730.1  CG3711-RB, transcript variant B (CG3711), mRNA 
0   NM_130513.2  CG3711-RA, transcript variant A (CG3711), mRNA 
0   NM_141998.1  CG11670-RA (CG11670), mRNA 
0   NM_165497.1  CG3358-RA, transcript variant A (CG3358), mRNA 
0   NM_136404.2  CG3358-RB, transcript variant B (CG3358), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
DM
VM
+- 
VB
+- 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.