National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13674R-3 
 Symbol CG13674  Full Name CG13674 
 CG No CG13674  Old CG No CG13674 
 Synonyms CG13674 
 Accession No (Link to NCBI) NM_139935.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCTTCGCTGTTGTGGCTGTG 
 Primer Seq. 3'
aatctagaggtaccTTCTTCAGCAGAACTGGGGCA 
 Predicted Fragment Size
389 
 IR fragment full Seq
0001 TTCTTCGCTG TTGTGGCTGT GNCTGCTGCC AAACCCGGTA TTGTGGCTCC TCTGGCCTAC 
0061 ACCGCTCCGG CTGTGGTGGG CAGTGCCGCC TACGTGGCTC CCTTACGCCT CCAAGCTACA 
0121 CCGCCAACTC GGTGGCCCAC AGCGCCGCCT NTCCCAGCTG CCTACACCGC CGCCTACACC 
0181 GCTCCCGTTG CTGCAGCCNT ACGCCGCTCC AGTGGCTGCT GCTTATACCG CTCCAGTGGC 
0241 CGCTGCGTAC GNCGCCCCAG CTGNCTATAC CGCTGCCTAC ACCGCCCCCA TTGCCCGTTA 
0301 TGCCGCCACC CCCTTCGCAG CACCCATCGC CGCTCCCGTG GCTGCCGCCT ACACCGCCCC 
0361 CANTCGCCGC NGCTGCCCCA GTTCTGCTGA AGAA 
 in silico PCR Fragment
0001 TTCTTCGCTG TTGTGGCTGT GGCTGCTGCC AAACCCGGTA TTGTGGCTCC TCTGGCCTAC 
0061 ACCGCTCCGG CTGTGGTGGG CAGTGCCGCC TACGTGGCTC CC-TACGCCT CC-AGCTACA 
0121 CCGCCAACTC GGTGGCCCAC AGCGCCGCCT -TCCCAGCTG CCTACACCGC CGCCTACACT 
0181 GCTCCCGTTG CTGCTGCC-T ATACCGCTCC AGTGGCTGCT GCTTATACCG CTCCAGTGGC 
0241 CGCTGCGTAC GCCGCCCCAG CTGCCTATAC CGCTGCCTAC ACCGCCCCCA TTGCCCGTTA 
0301 TGCCGCCACC CCCTTCGCAG CACCCATCGC CGCTCCCGTG GCTGCCGCCT ACACCGCCCC 
0361 CA-TCGCCGC CGCTGCCCCA GTTCTGCTGA AGAA 
 Assemble Data

13674R-3.IR_full       1   TTCTTCGCTGTTGTGGCTGTGNCTGCTGCCAAACCCGGTATTGTGGCTCCTCTGGCCTAC 60
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
13674R-3.in silico     1   TTCTTCGCTGTTGTGGCTGTGGCTGCTGCCAAACCCGGTATTGTGGCTCCTCTGGCCTAC 60


13674R-3.IR_full       61  ACCGCTCCGGCTGTGGTGGGCAGTGCCGCCTACGTGGCTCCCTTACGCCTCCAAGCTACA 120
                           |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||
13674R-3.in silico     61  ACCGCTCCGGCTGTGGTGGGCAGTGCCGCCTACGTGGCTCCC-TACGCCTCC-AGCTACA 120


13674R-3.IR_full       121 CCGCCAACTCGGTGGCCCACAGCGCCGCCTNTCCCAGCTGCCTACACCGCCGCCTACACC 180
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| 
13674R-3.in silico     121 CCGCCAACTCGGTGGCCCACAGCGCCGCCT-TCCCAGCTGCCTACACCGCCGCCTACACT 180


13674R-3.IR_full       181 GCTCCCGTTGCTGCAGCCNTACGCCGCTCCAGTGGCTGCTGCTTATACCGCTCCAGTGGC 240
                           |||||||||||||| ||| ||  |||||||||||||||||||||||||||||||||||||
13674R-3.in silico     181 GCTCCCGTTGCTGCTGCC-TATACCGCTCCAGTGGCTGCTGCTTATACCGCTCCAGTGGC 240


13674R-3.IR_full       241 CGCTGCGTACGNCGCCCCAGCTGNCTATACCGCTGCCTACACCGCCCCCATTGCCCGTTA 300
                           ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
13674R-3.in silico     241 CGCTGCGTACGCCGCCCCAGCTGCCTATACCGCTGCCTACACCGCCCCCATTGCCCGTTA 300


13674R-3.IR_full       301 TGCCGCCACCCCCTTCGCAGCACCCATCGCCGCTCCCGTGGCTGCCGCCTACACCGCCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13674R-3.in silico     301 TGCCGCCACCCCCTTCGCAGCACCCATCGCCGCTCCCGTGGCTGCCGCCTACACCGCCCC 360


13674R-3.IR_full       361 CANTCGCCGCNGCTGCCCCAGTTCTGCTGAAGAA 394
                           || ||||||| |||||||||||||||||||||||
13674R-3.in silico     361 CA-TCGCCGCCGCTGCCCCAGTTCTGCTGAAGAA 394

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   371  36  58  122  NM_139935.1  CG13674-RA (CG13674), mRNA 
23.98   89  34  47  137  NM_139936.1  CG13678-RA (CG13678), mRNA 
16.44   61  86  109  109  NM_139933.1  CG13679-RA, transcript variant A (CG13679), mRNA 
16.44   61  86  109  109  NM_168260.1  CG13679-RB, transcript variant B (CG13679), mRNA 
1.07   27  62  92  NM_140599.1  CG13068-RA (CG13068), mRNA 
0.53   20  45  NM_144160.1  CG13066-RA (CG13066), mRNA 
0.26   NM_167614.1  CG32549-RE, transcript variant E (CG32549), mRNA 
0   10  15  NM_144161.1  CG13069-RA (CG13069), mRNA 
0   37  112  NM_167394.1  CG32603-RA (CG32603), mRNA 
0   30  52  NM_140600.1  CG13067-RA, transcript variant A (CG13067), mRNA 
0   30  52  NM_206383.1  CG13067-RB, transcript variant B (CG13067), mRNA 
0   28  NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
0   13  38  NM_140605.1  CG13047-RA (CG13047), mRNA 
0   NM_206475.1  CG6959-RB, transcript variant B (CG6959), mRNA 
0   NM_141865.1  CG6959-RA, transcript variant A (CG6959), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   17  NM_137564.2  CG7417-RA (Tab2), mRNA 
0   16  NM_141072.2  CG7177-RA (CG7177), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_206531.1  CG5730-RC, transcript variant C (AnnIX), mRNA 
0   NM_057256.3  CG5730-RA, transcript variant A (AnnIX), mRNA 
0   NM_206530.1  CG5730-RD, transcript variant D (AnnIX), mRNA 
0   NM_057255.2  CG5730-RB, transcript variant B (AnnIX), mRNA 
0   15  26  NM_140610.2  CG13044-RA (CG13044), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.