National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13625R-1 
 Symbol CG13625  Full Name CG13625 
 CG No CG13625  Old CG No CG13625 
 Synonyms anon-WO0118547.376, CG13625 
 Accession No (Link to NCBI) NM_143015.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTACATCGAAGAGGATCCCAA 
 Primer Seq. 3'
aatctagaggtaccGTGATGCTTTTCCCGTTCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTACATCGAA GAGGATCCCA ATGTGCGCAG CAAGTGGCGC AACATTGCCG TCAAGGATGA 
0061 AATCAAAGAA GAGCACGAGG AATCCTCGCC AGCAACTGGC ATTCGCATCA AACAGGAGCC 
0121 CTTGGATGAG GAGCAGGAGA TGTGGGGACG CAAGGCGACA GTTGTTAAGG TTAAGGATGA 
0181 ATTCTCACCA TCCAGACGAA GTTCACCCGT CAGAATTAAG CAAGAAANAA CGCAGCAGCT 
0241 CTAGGGATTT AAGCCCAGCG AGATCGAGTA AGCCAGCAAA GCGNAGAAGA GAGTCCTCAA 
0301 AGGGGGCGAA GAAGGGCGGG AAGCTCAGAT CAGAGTCCCA CCAGACGAGG GCGAGATGGC 
0361 GATCAGTCTC CGCCACGCCA AAAGCACAGG GATTCCGATC AGAGTCCACC CCGAAAGGCC 
0421 AGGAATGGCA ATCAATCGCC AGTCAGAAAA AGGCGGGATT CCGACCAAAG TCCGCCAAGA 
0481 AAACGAACGG GAAAAGCATC AC 
 in silico PCR Fragment
0001 GTACATCGAA GAGGATCCCA ATGTGCGCAG CAAGTGGCGC AACATTGCCG TCAAGGATGA 
0061 AATCAAAGAA GAGCACGAGG AATCCTCGCC AGCAACTGGC ATTCGCATCA AACAGGAGCC 
0121 CTTGGATGAG GAGCAGGAGA TGTGGGGACG CAAGGCGACA GTTGTTAAGG TTAAGGATGA 
0181 ATTCTCACCA TCCAGACGAA GTTCACCCGT CAGAATTAAG CAAGAAA-AA CGCAGCAGCT 
0241 CTAGGGATTT AAGCCCAGCG AGATCGAGTA AGCCAGCAAA GCG-AGAAGA GAGTCCTCAA 
0301 AGGGGGCGAA GAAGGGCGGG AAGCTCAGAT CAGAGTCCCA CCAGACGAGG GCGAGATGGC 
0361 GATCAGTCTC CGCCACGCCA AAAGCACAGG GATTCCGATC AGAGTCCACC CCGAAAGGCC 
0421 AGGAATGGCA ATCAATCGCC AGTCAGAAAA AGGCGGGATT CCGACCAAAG TCCGCCAAGA 
0481 AAACGAACGG GAAAAGCATC AC 
 Assemble Data

13625R-1.IR_full       1   GTACATCGAAGAGGATCCCAATGTGCGCAGCAAGTGGCGCAACATTGCCGTCAAGGATGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     1   GTACATCGAAGAGGATCCCAATGTGCGCAGCAAGTGGCGCAACATTGCCGTCAAGGATGA 60


13625R-1.IR_full       61  AATCAAAGAAGAGCACGAGGAATCCTCGCCAGCAACTGGCATTCGCATCAAACAGGAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     61  AATCAAAGAAGAGCACGAGGAATCCTCGCCAGCAACTGGCATTCGCATCAAACAGGAGCC 120


13625R-1.IR_full       121 CTTGGATGAGGAGCAGGAGATGTGGGGACGCAAGGCGACAGTTGTTAAGGTTAAGGATGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     121 CTTGGATGAGGAGCAGGAGATGTGGGGACGCAAGGCGACAGTTGTTAAGGTTAAGGATGA 180


13625R-1.IR_full       181 ATTCTCACCATCCAGACGAAGTTCACCCGTCAGAATTAAGCAAGAAANAACGCAGCAGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
13625R-1.in silico     181 ATTCTCACCATCCAGACGAAGTTCACCCGTCAGAATTAAGCAAGAAA-AACGCAGCAGCT 240


13625R-1.IR_full       241 CTAGGGATTTAAGCCCAGCGAGATCGAGTAAGCCAGCAAAGCGNAGAAGAGAGTCCTCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13625R-1.in silico     241 CTAGGGATTTAAGCCCAGCGAGATCGAGTAAGCCAGCAAAGCG-AGAAGAGAGTCCTCAA 300


13625R-1.IR_full       301 AGGGGGCGAAGAAGGGCGGGAAGCTCAGATCAGAGTCCCACCAGACGAGGGCGAGATGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     301 AGGGGGCGAAGAAGGGCGGGAAGCTCAGATCAGAGTCCCACCAGACGAGGGCGAGATGGC 360


13625R-1.IR_full       361 GATCAGTCTCCGCCACGCCAAAAGCACAGGGATTCCGATCAGAGTCCACCCCGAAAGGCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     361 GATCAGTCTCCGCCACGCCAAAAGCACAGGGATTCCGATCAGAGTCCACCCCGAAAGGCC 420


13625R-1.IR_full       421 AGGAATGGCAATCAATCGCCAGTCAGAAAAAGGCGGGATTCCGACCAAAGTCCGCCAAGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13625R-1.in silico     421 AGGAATGGCAATCAATCGCCAGTCAGAAAAAGGCGGGATTCCGACCAAAGTCCGCCAAGA 480


13625R-1.IR_full       481 AAACGAACGGGAAAAGCATCAC 502
                           ||||||||||||||||||||||
13625R-1.in silico     481 AAACGAACGGGAAAAGCATCAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  23  64  NM_143015.2  CG13625-RA (CG13625), mRNA 
0.2   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0.2   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   11  NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_134539.1  CG1631-RA (CG1631), mRNA 
0   NM_205958.1  CG33303-RA (CG33303), mRNA 
0   NM_164546.1  CG3851-RA (odd), mRNA 
0   NM_078861.2  CG17332-RA, transcript variant A (VhaSFD), mRNA 
0   NM_165178.1  CG17332-RD, transcript variant D (VhaSFD), mRNA 
0   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_136080.1  CG10431-RA (CG10431), mRNA 
0   NM_132253.1  CG12116-RA (CG12116), mRNA 
0   NM_166440.1  CG30386-RA (CG30386), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_132443.1  CG16922-RA (CG16922), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_141538.1  CG7352-RA (CG7352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_057770.3  CG3193-RA (crn), mRNA 
0   NM_139398.1  CG7995-RA, transcript variant A (CG7995), mRNA 
0   NM_167912.1  CG7995-RB, transcript variant B (CG7995), mRNA 
0   NM_167914.1  CG7995-RD, transcript variant D (CG7995), mRNA 
0   NM_167915.1  CG7995-RE, transcript variant E (CG7995), mRNA 
0   NM_167913.1  CG7995-RC, transcript variant C (CG7995), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.