National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13599R-2 
 Symbol CG13599  Full Name CG13599 
 CG No CG13599  Old CG No CG13599 
 Synonyms CG13599 
 Accession No (Link to NCBI) NM_142937.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACATTGAGGTTCTGACCAGTG 
 Primer Seq. 3'
aatctagaggtaccGGTGACTTTTAGTTCGGTGGA 
 Predicted Fragment Size
476 
 IR fragment full Seq
0001 ACATTGAGGT TCTGACCAGT GGGACAACAG CGGAGTTCGT GAATGGCATC CTGGACTTCT 
0061 TGCTCTATCA ACGCCGGCAA ATCCCCTTCG TGTACAAAAC ATACAAATAT TATGTGGATA 
0121 AATGGTCAGA TGCTGATGAA TCGGGAGAAT CCAAGGATCA GGAGTCCTTT GCCCACTACC 
0181 AACGCAACCA GCAGCGCTCC AAGGCAAAGG CCACCAAGGA ATCAATTAGT GACATGAGAG 
0241 AGATCATCCG ACAAGCCTTC AGGAGCTCTG AAGTGAAGAG CCTGCGATTT CTTTTTGGCA 
0301 ACAATATGTT CATGCCCTCG GAGGCCTATA CTCTGCACAT ACCACATGAT TCCATATCCA 
0361 GAGATCACTA TTGCGAGCAC CATGCTCTGC CCGAAGGTCG CATCAACCAG GCGCTGCTCC 
0421 GCCTGCTCAC CTGCGAGGAG CTGCACAGGC TATTCTCCAC CGAACTAAAA GTCACC 
 in silico PCR Fragment
0001 ACATTGAGGT TCTGACCAGT GGGACAACAG CGGAGTTCGT GAATGGCATC CTGGACTTCT 
0061 TGCTCTATCA ACGCCGGCAA ATCCCCTTCG TGTACAAAAC ATACAAATAT TATGTGGATA 
0121 AATGGTCAGA TGCTGATGAA TCGGGAGAAT CCAAGGATCA GGAGTCCTTT GCTCATTACC 
0181 AACGCAACCA GCAGCGCTCT AAGGCAAAGG CCACCAAGGA ATCTATTAGT GACATGAGAG 
0241 AGATCATCCG ACAAGCCTTC AGGAGCTCTG AAGTGAAGAG CCTGCGATTT CTTTTTGGCA 
0301 ACAATATGTT CATGCCCTCG GAGGCCTATA CTCTGCACAT ACCACATGAT TCCATATCCA 
0361 GAGATCACTA TTGCGAGCAC CATGCTCTGC CCGAAGGTCG CATCAACCAG GCGCTGCTCC 
0421 GCCTGCTCAC CTGCGAGGAG CTGTACAGGC TATTCTCCAC CGAACTAAAA GTCACC 
 Assemble Data

13599R-2.IR_full       1   ACATTGAGGTTCTGACCAGTGGGACAACAGCGGAGTTCGTGAATGGCATCCTGGACTTCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13599R-2.in silico     1   ACATTGAGGTTCTGACCAGTGGGACAACAGCGGAGTTCGTGAATGGCATCCTGGACTTCT 60


13599R-2.IR_full       61  TGCTCTATCAACGCCGGCAAATCCCCTTCGTGTACAAAACATACAAATATTATGTGGATA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13599R-2.in silico     61  TGCTCTATCAACGCCGGCAAATCCCCTTCGTGTACAAAACATACAAATATTATGTGGATA 120


13599R-2.IR_full       121 AATGGTCAGATGCTGATGAATCGGGAGAATCCAAGGATCAGGAGTCCTTTGCCCACTACC 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
13599R-2.in silico     121 AATGGTCAGATGCTGATGAATCGGGAGAATCCAAGGATCAGGAGTCCTTTGCTCATTACC 180


13599R-2.IR_full       181 AACGCAACCAGCAGCGCTCCAAGGCAAAGGCCACCAAGGAATCAATTAGTGACATGAGAG 240
                           ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||
13599R-2.in silico     181 AACGCAACCAGCAGCGCTCTAAGGCAAAGGCCACCAAGGAATCTATTAGTGACATGAGAG 240


13599R-2.IR_full       241 AGATCATCCGACAAGCCTTCAGGAGCTCTGAAGTGAAGAGCCTGCGATTTCTTTTTGGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13599R-2.in silico     241 AGATCATCCGACAAGCCTTCAGGAGCTCTGAAGTGAAGAGCCTGCGATTTCTTTTTGGCA 300


13599R-2.IR_full       301 ACAATATGTTCATGCCCTCGGAGGCCTATACTCTGCACATACCACATGATTCCATATCCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13599R-2.in silico     301 ACAATATGTTCATGCCCTCGGAGGCCTATACTCTGCACATACCACATGATTCCATATCCA 360


13599R-2.IR_full       361 GAGATCACTATTGCGAGCACCATGCTCTGCCCGAAGGTCGCATCAACCAGGCGCTGCTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13599R-2.in silico     361 GAGATCACTATTGCGAGCACCATGCTCTGCCCGAAGGTCGCATCAACCAGGCGCTGCTCC 420


13599R-2.IR_full       421 GCCTGCTCACCTGCGAGGAGCTGCACAGGCTATTCTCCACCGAACTAAAAGTCACC 476
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
13599R-2.in silico     421 GCCTGCTCACCTGCGAGGAGCTGTACAGGCTATTCTCCACCGAACTAAAAGTCACC 476

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   458  NM_142937.2  CG13599-RA (CG13599), mRNA 
1.09   NM_079443.1  CG8548-RA (Kap-alpha1), mRNA 
0   NM_137367.2  CG18467-RA (CG18467), mRNA 
0   NM_136137.2  CG10137-RA (CG10137), mRNA 
0   NM_166704.1  CG15792-RB, transcript variant B (zip), mRNA 
0   NM_001014553.1  CG15792-RC, transcript variant C (zip), mRNA 
0   NM_079136.2  CG15792-RA, transcript variant A (zip), mRNA 
0   NM_001014552.1  CG15792-RD, transcript variant D (zip), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_206495.1  CG4898-RK, transcript variant K (Tm1), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0   NM_168775.1  CG4059-RA, transcript variant A (ftz-f1), mRNA 
0   NM_079419.2  CG4059-RB, transcript variant B (ftz-f1), mRNA 
0   NM_079363.3  CG7450-RA, transcript variant A (CrebA), mRNA 
0   NM_206374.1  CG7450-RB, transcript variant B (CrebA), mRNA 
0   NM_136707.2  CG1371-RA (CG1371), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_078601.2  CG9533-RA (rut), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   NM_079901.2  CG10811-RA (eIF-4G), mRNA 
0   NM_134673.2  CG11912-RA (CG11912), mRNA 
0   NM_135925.2  CG13243-RA (CG13243), mRNA 
0   NM_132347.1  CG3099-RB (CG3099), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.